ID: 931936750

View in Genome Browser
Species Human (GRCh38)
Location 2:67206710-67206732
Sequence TGACACATGGGTCATATAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931936750_931936757 15 Left 931936750 2:67206710-67206732 CCAATTATATGACCCATGTGTCA No data
Right 931936757 2:67206748-67206770 GTAGTAGGATTTTGAAAATTGGG No data
931936750_931936753 -7 Left 931936750 2:67206710-67206732 CCAATTATATGACCCATGTGTCA No data
Right 931936753 2:67206726-67206748 TGTGTCACACCTTTATGTCAAGG No data
931936750_931936759 21 Left 931936750 2:67206710-67206732 CCAATTATATGACCCATGTGTCA No data
Right 931936759 2:67206754-67206776 GGATTTTGAAAATTGGGTTTGGG No data
931936750_931936754 0 Left 931936750 2:67206710-67206732 CCAATTATATGACCCATGTGTCA No data
Right 931936754 2:67206733-67206755 CACCTTTATGTCAAGGTAGTAGG No data
931936750_931936758 20 Left 931936750 2:67206710-67206732 CCAATTATATGACCCATGTGTCA No data
Right 931936758 2:67206753-67206775 AGGATTTTGAAAATTGGGTTTGG No data
931936750_931936756 14 Left 931936750 2:67206710-67206732 CCAATTATATGACCCATGTGTCA No data
Right 931936756 2:67206747-67206769 GGTAGTAGGATTTTGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931936750 Original CRISPR TGACACATGGGTCATATAAT TGG (reversed) Intergenic
No off target data available for this crispr