ID: 931936925

View in Genome Browser
Species Human (GRCh38)
Location 2:67208976-67208998
Sequence AGGTTAATACTGATAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931936924_931936925 -5 Left 931936924 2:67208958-67208980 CCACATTTAAAATAAATAAGGTT No data
Right 931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG No data
931936923_931936925 -4 Left 931936923 2:67208957-67208979 CCCACATTTAAAATAAATAAGGT No data
Right 931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG No data
931936921_931936925 -1 Left 931936921 2:67208954-67208976 CCTCCCACATTTAAAATAAATAA No data
Right 931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931936925 Original CRISPR AGGTTAATACTGATAGAACA AGG Intergenic
No off target data available for this crispr