ID: 931937813

View in Genome Browser
Species Human (GRCh38)
Location 2:67217585-67217607
Sequence TTCTGGGAAGGGTCATCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931937813_931937819 -4 Left 931937813 2:67217585-67217607 CCTTAGGATGACCCTTCCCAGAA No data
Right 931937819 2:67217604-67217626 AGAAGCTGGTGTCATGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931937813 Original CRISPR TTCTGGGAAGGGTCATCCTA AGG (reversed) Intergenic