ID: 931938359

View in Genome Browser
Species Human (GRCh38)
Location 2:67223574-67223596
Sequence TGTCAGTTAGGGCACTTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931938359_931938365 11 Left 931938359 2:67223574-67223596 CCCCTAAAGTGCCCTAACTGACA No data
Right 931938365 2:67223608-67223630 AAACTCTCCCCCTCTTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931938359 Original CRISPR TGTCAGTTAGGGCACTTTAG GGG (reversed) Intergenic
No off target data available for this crispr