ID: 931939287

View in Genome Browser
Species Human (GRCh38)
Location 2:67234367-67234389
Sequence GGGTCTCACTGAGACCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931939287_931939296 26 Left 931939287 2:67234367-67234389 CCTTCAAGGTCTCAGTGAGACCC No data
Right 931939296 2:67234416-67234438 TTCATGGCTCACTGAATGGCAGG No data
931939287_931939295 22 Left 931939287 2:67234367-67234389 CCTTCAAGGTCTCAGTGAGACCC No data
Right 931939295 2:67234412-67234434 ATCATTCATGGCTCACTGAATGG No data
931939287_931939289 -6 Left 931939287 2:67234367-67234389 CCTTCAAGGTCTCAGTGAGACCC No data
Right 931939289 2:67234384-67234406 AGACCCAGTCTCCCTTGGAGAGG No data
931939287_931939294 10 Left 931939287 2:67234367-67234389 CCTTCAAGGTCTCAGTGAGACCC No data
Right 931939294 2:67234400-67234422 GGAGAGGACTTGATCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931939287 Original CRISPR GGGTCTCACTGAGACCTTGA AGG (reversed) Intergenic
No off target data available for this crispr