ID: 931942469

View in Genome Browser
Species Human (GRCh38)
Location 2:67267651-67267673
Sequence AGCCCCCACTTGCTTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931942469_931942474 -3 Left 931942469 2:67267651-67267673 CCCCAAAAAAGCAAGTGGGGGCT 0: 1
1: 0
2: 1
3: 15
4: 162
Right 931942474 2:67267671-67267693 GCTAGATGGGATTAGACAGATGG 0: 1
1: 0
2: 1
3: 8
4: 129
931942469_931942475 5 Left 931942469 2:67267651-67267673 CCCCAAAAAAGCAAGTGGGGGCT 0: 1
1: 0
2: 1
3: 15
4: 162
Right 931942475 2:67267679-67267701 GGATTAGACAGATGGAGTGTAGG 0: 1
1: 0
2: 1
3: 18
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931942469 Original CRISPR AGCCCCCACTTGCTTTTTTG GGG (reversed) Intergenic
901200420 1:7463883-7463905 AAACGCCACTTTCTTTTTTGAGG + Intronic
901752888 1:11422427-11422449 AGGGCCCACTTGCTGTCTTGGGG - Intergenic
903933277 1:26876911-26876933 AGCCCCCATTTGGTTTGTTATGG + Exonic
905061457 1:35143209-35143231 AGCCTGCATTTGCTTTTTTAAGG + Intergenic
905870873 1:41403964-41403986 AGCCCCAACTTTCTGTTCTGTGG - Intergenic
912403562 1:109417375-109417397 TGCCACCATTTCCTTTTTTGAGG - Intronic
913997869 1:143666117-143666139 AGGCACCACTTGCCTCTTTGTGG + Intergenic
916364557 1:164010191-164010213 AGCCCACAATTTCTCTTTTGAGG + Intergenic
919650026 1:200138934-200138956 AGACCCCACTGGGTTCTTTGTGG - Intronic
922336176 1:224619779-224619801 AGCGCCCAATTCATTTTTTGGGG - Intronic
922720539 1:227898208-227898230 AGCCCCCGTTTCCTTTTCTGAGG + Intergenic
1066240343 10:33527430-33527452 AGCCCCCACTTTCTGGGTTGAGG + Intergenic
1066525980 10:36280303-36280325 AGCCCTCACATGCTGTTTTGTGG - Intergenic
1067001243 10:42615922-42615944 AGCCGACAATTGTTTTTTTGAGG - Intronic
1067063249 10:43089019-43089041 AGCCTCCACTTGCCTGTCTGTGG + Intronic
1067409949 10:46055480-46055502 AGCCCCCACCTGCTGCTCTGGGG - Intergenic
1069358673 10:67616464-67616486 AGACCACACTGGCTTCTTTGAGG + Intronic
1070500773 10:77070688-77070710 AGCCCTCACTTACTTTTGTTGGG - Intronic
1072871236 10:99123535-99123557 CGCCCCCACTTGCCTTGTTGTGG - Intronic
1073747864 10:106490541-106490563 AGCCCCATCTTGCTCCTTTGTGG + Intergenic
1076447291 10:130525331-130525353 AGCCTTCACTTACCTTTTTGAGG - Intergenic
1078456085 11:11476653-11476675 AGCCCCCACTGTCTCTTTTCAGG + Intronic
1078588720 11:12619043-12619065 AAGCCCCACTTGCTTTTTAAGGG - Intergenic
1078663219 11:13303854-13303876 AGAACCCACTTCCTTTTTTTAGG - Intronic
1079023760 11:16929620-16929642 AGCCCCTACTTTCCTTTTAGGGG + Intronic
1080683263 11:34495519-34495541 AGCCTCTATTTCCTTTTTTGTGG - Intronic
1081510743 11:43770371-43770393 AGCACCTACTTGCTTTTATTAGG + Intronic
1081560690 11:44212907-44212929 AGCTCCTTCTTGCTTTTTTGTGG - Intronic
1086686786 11:89742388-89742410 TGTCCCCACTTACTTTTTAGAGG + Intergenic
1087000295 11:93412241-93412263 AGGCCCCAGTTGCTTTGCTGGGG - Intronic
1093368234 12:18331721-18331743 ATCCCCGCCTTGCTATTTTGAGG + Intronic
1095514901 12:42994877-42994899 TGCCCCCATTTTCTTTTCTGTGG - Intergenic
1095775415 12:46004385-46004407 AGGCCTCACTTGGTTTTATGGGG + Intergenic
1096742286 12:53702553-53702575 GGCCCCCACTTACTGTTGTGAGG - Intergenic
1098481472 12:70966888-70966910 GGCCCTCAGTTTCTTTTTTGAGG - Intergenic
1099346403 12:81505621-81505643 AGCCTCCACTTGCAATTTTGTGG - Intronic
1099561186 12:84175541-84175563 AGCCCCCACACACTTTTCTGAGG - Intergenic
1099989383 12:89707906-89707928 CGCCCCCACCTCCCTTTTTGAGG - Intronic
1100529501 12:95450787-95450809 AACCCCCCCTTTTTTTTTTGCGG + Intergenic
1101246901 12:102891981-102892003 TGCCCTCCCTTGCTTTTTTCCGG - Intronic
1102602884 12:114046127-114046149 TGTCCACCCTTGCTTTTTTGGGG + Intergenic
1107869843 13:44736332-44736354 AGCCCCCACCTGCAGTTTTTTGG + Intergenic
1108142024 13:47433606-47433628 AACCCCCATTAGCTTTTATGTGG - Intergenic
1113346592 13:109483744-109483766 GGCCCCTACTTCTTTTTTTGTGG - Intergenic
1114131343 14:19796830-19796852 ATCCTCCGCTTGCCTTTTTGTGG + Intronic
1114134178 14:19827935-19827957 ATCCTCCGCTTGCCTTTTTGTGG + Exonic
1115336665 14:32249214-32249236 TCCACCTACTTGCTTTTTTGGGG - Intergenic
1118095708 14:62535176-62535198 AACCCAAACTTCCTTTTTTGGGG - Intergenic
1119903393 14:78281088-78281110 ACCAACCCCTTGCTTTTTTGTGG + Intronic
1121622967 14:95362983-95363005 AGCCCACACTCCCTTTTCTGGGG - Intergenic
1123574405 15:21652421-21652443 ATCCTCCGCTTGCCTTTTTGTGG + Intergenic
1123611020 15:22095008-22095030 ATCCTCCGCTTGCCTTTTTGTGG + Exonic
1126484897 15:49169483-49169505 TGCCCCCAGTTGCTTTCTAGTGG + Intronic
1127694981 15:61436637-61436659 AGCCCCCACTCTCTCTTTTCTGG - Intergenic
1128013716 15:64323223-64323245 AGCCTCCTCTTGCTTTTGTGTGG + Intronic
1130945163 15:88545700-88545722 ATTCCCCACTTGTGTTTTTGGGG - Intronic
1202983268 15_KI270727v1_random:386764-386786 ATCCTCCGCTTGCCTTTTTGTGG + Intergenic
1133745012 16:8679715-8679737 AGCCCCCACTGTCCTTTCTGAGG - Intronic
1134384657 16:13760379-13760401 AGCCCCCACCAGCGTATTTGGGG + Intergenic
1134781192 16:16896973-16896995 GGCCCCCAATTTCTTTTTGGGGG + Intergenic
1137455858 16:48617320-48617342 AGCCTCCACTTCCTTTTTCATGG + Intronic
1145716378 17:27027117-27027139 AGGCTCCACTTCCTTTTTTGGGG + Intergenic
1146072461 17:29695846-29695868 AGCACCCACTGGCTGTTTTTGGG + Intronic
1147819101 17:43231301-43231323 AGGCCCCGCCTGCTTTGTTGAGG - Intergenic
1147832384 17:43306006-43306028 AGGCCCCGCCTGCTTTGTTGAGG - Intergenic
1147906193 17:43824692-43824714 TGCCCAAGCTTGCTTTTTTGTGG - Intronic
1149666115 17:58365707-58365729 TGCCTCCACTTACTTTCTTGGGG - Intronic
1149819667 17:59763742-59763764 AGAGCCCACTTACTTTTCTGTGG + Intronic
1150454384 17:65294997-65295019 AGCCTCCTCTTGCTTCTTTAAGG - Intergenic
1151301639 17:73231699-73231721 AGCCCCCAAAGGCTTTTGTGAGG - Intronic
1153158057 18:2171515-2171537 AGCACCCACAGGCTTTTGTGTGG + Intergenic
1157638239 18:49184157-49184179 AGCCCTAACTTGCTTTTTAGTGG - Intronic
1157777611 18:50408145-50408167 ATTCCCCACTTGTGTTTTTGGGG - Intergenic
1160701873 19:511450-511472 AGGCCCCACCTGCTTATTTTGGG - Intronic
1162377657 19:10314803-10314825 AGCCCACACTGGCTTTCTTGTGG - Intronic
1163475548 19:17523885-17523907 GGCCCTCGCTTTCTTTTTTGGGG + Intronic
1163867083 19:19782521-19782543 AGTCCACACTTGCTCTTTAGTGG + Intergenic
1164130716 19:22358820-22358842 AGTCCACACTTGCTCTTTAGTGG + Intergenic
1165252664 19:34553238-34553260 ATTCCCCACTTGTGTTTTTGGGG + Intergenic
1165522451 19:36325429-36325451 ATTCCCCACTTGTGTTTTTGGGG + Intergenic
1165658617 19:37555298-37555320 ATTCCCCACTTGTGTTTTTGGGG + Intronic
1167683075 19:50937637-50937659 AGACCCCACTGGTTTTTCTGAGG + Intergenic
925010970 2:485979-486001 TGCCCCCACTTCTTTTTCTGAGG + Intergenic
926802492 2:16671362-16671384 ATCCCCCACTTCTCTTTTTGGGG - Intergenic
930362134 2:50394587-50394609 AGCCACCACTGTCTCTTTTGTGG + Intronic
930491775 2:52082790-52082812 ACACCTCACTAGCTTTTTTGAGG - Intergenic
930617779 2:53611499-53611521 TCCCACCACTGGCTTTTTTGAGG - Intronic
931632345 2:64312365-64312387 AGCCCCAACTTGCTTTCATGGGG - Intergenic
931942469 2:67267651-67267673 AGCCCCCACTTGCTTTTTTGGGG - Intergenic
932883112 2:75522776-75522798 ATCCCACACTAGCTGTTTTGTGG - Intronic
936938734 2:117861301-117861323 AGCCTCAACTTTCTCTTTTGAGG + Intergenic
939204581 2:139084027-139084049 AGCCCCCTCTGGCAGTTTTGTGG + Intergenic
939961698 2:148571089-148571111 TGACTCCACTTGCTTCTTTGTGG - Intergenic
944896478 2:204170679-204170701 AGCCCCCTCTGGCTATTGTGTGG + Intergenic
948886989 2:240889452-240889474 AGCCCCCACCTGCTTCCTCGGGG + Intronic
1169979232 20:11364750-11364772 TCCCCCCACTTTTTTTTTTGAGG - Intergenic
1170609885 20:17903906-17903928 AGCCCCCACTCACTCCTTTGGGG - Intergenic
1170850611 20:20000805-20000827 AGCTCCGCCTTGATTTTTTGAGG - Exonic
1175246315 20:57584378-57584400 AGCTCCCACTTGCACTGTTGAGG + Intergenic
1180754117 22:18148454-18148476 TGCCCTCACTTGAGTTTTTGAGG + Intergenic
1180839434 22:18952277-18952299 AGAGCCCCCTTGCTCTTTTGGGG - Intergenic
1181161317 22:20961641-20961663 AGCACCCACTGGATTCTTTGGGG - Intergenic
1182238838 22:28898244-28898266 AGCCAAGACTTGTTTTTTTGAGG + Intronic
1184980743 22:48094424-48094446 AGCCCCTCCTCTCTTTTTTGGGG - Intergenic
949496412 3:4636143-4636165 AGCCCAGACTTGGTTTTGTGAGG + Intronic
949571721 3:5300171-5300193 ATCCCCCACATTCTCTTTTGTGG - Intergenic
950637617 3:14325941-14325963 AGCTCCCACTTCCTTTTGGGAGG - Intergenic
952781966 3:37109597-37109619 AGCTACCAGTTGCTTTTTTTGGG - Intronic
954265530 3:49468359-49468381 AGCCCCCCCTTTTTTTTTTTTGG + Intergenic
957232319 3:77536224-77536246 TCCCCCCACCTGCTTCTTTGTGG - Intronic
959064315 3:101641487-101641509 ATTCCCCACTTGTGTTTTTGGGG - Intergenic
962361635 3:134748080-134748102 AGCCCCCACTTTCTATCTTTTGG + Intronic
963241967 3:143013929-143013951 TGCCTCCATTTGCTTATTTGAGG + Intronic
964300937 3:155284349-155284371 AGACCACACTTGGTTTATTGAGG - Intergenic
964401968 3:156309360-156309382 AGCCCTCTCTAGCTTTTATGTGG + Intronic
965103735 3:164334492-164334514 ATTCCCCACTTGTGTTTTTGGGG + Intergenic
969805648 4:9606673-9606695 ATTCCTCACTTGTTTTTTTGGGG - Intergenic
972754795 4:42034759-42034781 AGGCCCCACTTGCTATTCTTTGG + Intronic
975129077 4:70814488-70814510 AGCCCCATCTTGCTTTCTTGAGG + Intergenic
982105890 4:152011828-152011850 TGCCCCAACTGGCATTTTTGGGG - Intergenic
984852631 4:184167582-184167604 ATCCCCCGCCCGCTTTTTTGGGG + Intronic
984877139 4:184379545-184379567 AGCCTCCACTACCATTTTTGAGG + Intergenic
986508051 5:8473422-8473444 AGACCCCATTTGCTTATCTGTGG - Intergenic
986627311 5:9734365-9734387 AGCTCCCTCTCCCTTTTTTGGGG + Intergenic
993835023 5:92809369-92809391 AAGGCCCACTTGCTTTTTTGGGG - Intergenic
994080870 5:95707886-95707908 ATTCCCCACTTGTGTTTTTGGGG + Intergenic
995029050 5:107459099-107459121 AGCCTCCAATTGATATTTTGAGG - Intronic
997308832 5:132862678-132862700 AACCCCCATTTTTTTTTTTGAGG - Intronic
998653073 5:144143040-144143062 ATCTCCCACATGCATTTTTGAGG + Intergenic
999519705 5:152338576-152338598 TTCCCCCGCTTGCTTTTTTTTGG + Intergenic
999839752 5:155412557-155412579 AGCCCCGATTTTCTTTTGTGGGG - Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000795697 5:165661768-165661790 AGCTCCCTCTTCCTTTTTTAAGG + Intergenic
1001495579 5:172185933-172185955 AGCCCACACTTCCTGTTATGGGG - Intronic
1002445327 5:179287021-179287043 ATCCCCCAGTTCCTTTGTTGAGG - Intronic
1002671147 5:180868414-180868436 AGGCCCCTCTTCCTTTTTTATGG - Intergenic
1005737993 6:28766759-28766781 ATTCCCCACTTGTGTTTTTGGGG + Intergenic
1007080612 6:39100450-39100472 TGCCCCCACCTTCTTTTTTGGGG + Intergenic
1008479488 6:51970457-51970479 AGGTCCCACTTGCTTATTTTTGG + Intronic
1009563646 6:65280018-65280040 AGCAACCACTTATTTTTTTGTGG + Intronic
1011356968 6:86481115-86481137 ATTCCCCACTTGTGTTTTTGGGG - Intergenic
1014047824 6:116913358-116913380 AGCCAGCACTTGCTTCTTTAAGG + Intronic
1015963582 6:138675368-138675390 GGCCTCCACTTGCCTTTTGGAGG - Intronic
1017309629 6:152960103-152960125 AGCCCACACATGCTTTTTTGAGG - Intergenic
1017835877 6:158177450-158177472 AGTCCCCATCAGCTTTTTTGGGG - Intronic
1019344346 7:522128-522150 GACCCCCACAGGCTTTTTTGGGG + Intergenic
1020686751 7:11305894-11305916 AGCAACCACATGCTTTTTTCTGG + Intergenic
1027578211 7:79958097-79958119 AGCTCCGTCTTGCTTTCTTGCGG - Intergenic
1028276736 7:88866427-88866449 AGCTTCCACTTTCTCTTTTGAGG + Intronic
1030207161 7:106962110-106962132 TGCTCCCACTTGCTTGTTTAAGG + Intergenic
1032799273 7:135305534-135305556 AGCCCTCACTTGCTTTTGGGTGG + Intergenic
1034407273 7:150913408-150913430 AGCCCCCACTTGCCTTGTTCTGG - Intergenic
1034554282 7:151839995-151840017 AGCCCCCACTCTCTTTGTTAGGG - Intronic
1035874180 8:3169807-3169829 ACCCCCCACTTTCTTCTTTCTGG + Intronic
1036550428 8:9810717-9810739 AGCCCCCACTGCCATTTGTGGGG + Intergenic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1043577290 8:81672704-81672726 TGCCTGCACTTCCTTTTTTGAGG + Intronic
1044463385 8:92474665-92474687 AGCCTCCTCTTTCATTTTTGGGG - Intergenic
1045183732 8:99814846-99814868 AGCCCTTACTTTCTTTTTTATGG + Intronic
1046610639 8:116420484-116420506 AGCCCTCACTTTCTTTTTAATGG - Intergenic
1047325173 8:123829133-123829155 GCCTCTCACTTGCTTTTTTGAGG + Intergenic
1049572515 8:143375919-143375941 AGCCCCCACGTGCACTGTTGGGG - Intronic
1050533137 9:6608113-6608135 GGCCCTCAATTGTTTTTTTGAGG - Intronic
1051453646 9:17227190-17227212 AGCCCCCACTTTCAGCTTTGGGG + Intronic
1054751593 9:68912669-68912691 CTCCCCCACTTGCTTGTTTTTGG - Intronic
1055290667 9:74778970-74778992 AGCCCCCACTTACCTTCCTGGGG + Intronic
1057153452 9:92816826-92816848 AGCCGTCACTTGCATTTTTAAGG - Intergenic
1057672627 9:97107536-97107558 AGGTCCCTCCTGCTTTTTTGGGG - Intergenic
1059372426 9:113853390-113853412 ATCACCCACTTGCTTTCTTTTGG + Intergenic
1185761831 X:2694251-2694273 AGCCCACACTTGCTCTACTGGGG - Intronic
1186099538 X:6140861-6140883 AGCCACCACTTTCTAATTTGTGG + Intronic
1187198360 X:17110084-17110106 AGACCACACATACTTTTTTGGGG + Intronic
1189256715 X:39645466-39645488 CGCCCCCACTGGCTCTTTGGCGG - Intergenic
1192584637 X:72309309-72309331 AGCCACCCCTTTCCTTTTTGGGG + Intergenic
1193724971 X:85027334-85027356 AGCCCCCACTTCCTATATTGGGG + Intronic
1196222084 X:113123209-113123231 AGCCCTCAAATGCTTTTATGGGG - Intergenic
1199951641 X:152711682-152711704 TCCCCCCACTTGCTTCATTGTGG - Intergenic
1199958042 X:152756766-152756788 TCCCCCCACTTGCTTCATTGTGG + Intergenic
1201947861 Y:19531292-19531314 AGCCCCCACCTGTATTTTAGAGG + Intergenic