ID: 931947353

View in Genome Browser
Species Human (GRCh38)
Location 2:67324938-67324960
Sequence ACCCGGGTGGAATGCTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931947353_931947363 25 Left 931947353 2:67324938-67324960 CCCCCTGAGCATTCCACCCGGGT 0: 1
1: 0
2: 2
3: 10
4: 87
Right 931947363 2:67324986-67325008 TCAAGTAAATGCACTGGACTTGG No data
931947353_931947362 19 Left 931947353 2:67324938-67324960 CCCCCTGAGCATTCCACCCGGGT 0: 1
1: 0
2: 2
3: 10
4: 87
Right 931947362 2:67324980-67325002 GTCATATCAAGTAAATGCACTGG No data
931947353_931947360 -7 Left 931947353 2:67324938-67324960 CCCCCTGAGCATTCCACCCGGGT 0: 1
1: 0
2: 2
3: 10
4: 87
Right 931947360 2:67324954-67324976 CCCGGGTAAAAAAGGAACTAAGG 0: 1
1: 0
2: 1
3: 6
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931947353 Original CRISPR ACCCGGGTGGAATGCTCAGG GGG (reversed) Intergenic