ID: 931949374

View in Genome Browser
Species Human (GRCh38)
Location 2:67345250-67345272
Sequence ACAACAGCTGCTAATGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931949369_931949374 30 Left 931949369 2:67345197-67345219 CCCTGCAAACAAGGGAACTGAAG No data
Right 931949374 2:67345250-67345272 ACAACAGCTGCTAATGTTAATGG No data
931949370_931949374 29 Left 931949370 2:67345198-67345220 CCTGCAAACAAGGGAACTGAAGT No data
Right 931949374 2:67345250-67345272 ACAACAGCTGCTAATGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931949374 Original CRISPR ACAACAGCTGCTAATGTTAA TGG Intergenic
No off target data available for this crispr