ID: 931953486

View in Genome Browser
Species Human (GRCh38)
Location 2:67391710-67391732
Sequence CTGCTTCATAATTTTAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931953483_931953486 11 Left 931953483 2:67391676-67391698 CCTGAGCAAAATTAGATATGACA No data
Right 931953486 2:67391710-67391732 CTGCTTCATAATTTTAATGAGGG No data
931953482_931953486 12 Left 931953482 2:67391675-67391697 CCCTGAGCAAAATTAGATATGAC No data
Right 931953486 2:67391710-67391732 CTGCTTCATAATTTTAATGAGGG No data
931953481_931953486 15 Left 931953481 2:67391672-67391694 CCACCCTGAGCAAAATTAGATAT No data
Right 931953486 2:67391710-67391732 CTGCTTCATAATTTTAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931953486 Original CRISPR CTGCTTCATAATTTTAATGA GGG Intergenic
No off target data available for this crispr