ID: 931954062

View in Genome Browser
Species Human (GRCh38)
Location 2:67397877-67397899
Sequence CTGTGGCGGAGGCAAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931954062_931954071 8 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954071 2:67397908-67397930 AATGTGGTTTACCTGTTTGCGGG 0: 1
1: 0
2: 2
3: 9
4: 121
931954062_931954070 7 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954070 2:67397907-67397929 TAATGTGGTTTACCTGTTTGCGG 0: 1
1: 0
2: 0
3: 10
4: 205
931954062_931954074 15 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954074 2:67397915-67397937 TTTACCTGTTTGCGGGAGGGCGG 0: 1
1: 0
2: 1
3: 14
4: 118
931954062_931954072 11 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954072 2:67397911-67397933 GTGGTTTACCTGTTTGCGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 45
931954062_931954068 -8 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954068 2:67397892-67397914 CGCCACAGGAATAGGTAATGTGG 0: 1
1: 0
2: 0
3: 2
4: 53
931954062_931954076 27 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954076 2:67397927-67397949 CGGGAGGGCGGCTGCTTTCCAGG 0: 1
1: 1
2: 1
3: 28
4: 179
931954062_931954073 12 Left 931954062 2:67397877-67397899 CCATCCATTTGCCTCCGCCACAG 0: 1
1: 0
2: 0
3: 14
4: 179
Right 931954073 2:67397912-67397934 TGGTTTACCTGTTTGCGGGAGGG 0: 1
1: 0
2: 1
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931954062 Original CRISPR CTGTGGCGGAGGCAAATGGA TGG (reversed) Intronic
900575818 1:3382019-3382041 CTGTGGCAGAGGAAGATGGCAGG + Intronic
901037368 1:6344348-6344370 CTGTGGGGAAGGCTACTGGATGG - Intronic
901313492 1:8288803-8288825 ATGAGGTGGAGGCAGATGGATGG - Intergenic
904442441 1:30540535-30540557 CTGTGGCAGGGCCAAAGGGAAGG + Intergenic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907514148 1:54982525-54982547 CTGTGGGGGATCCACATGGAAGG + Intronic
907921635 1:58919464-58919486 CTGCGGGGCAGGGAAATGGACGG + Intergenic
908028778 1:59977871-59977893 CTGTGGCTGAGGCTAAAGAAGGG - Intergenic
908771975 1:67605780-67605802 CTGAGGCAGAGGAAACTGGAGGG + Intergenic
909581384 1:77239673-77239695 GTGGGGCGGAGGCACATTGAAGG + Intergenic
909676209 1:78241657-78241679 CTGTGGAAGAAGCAACTGGAAGG - Intergenic
912679841 1:111722096-111722118 GGGTGGAGGAGGCAAAAGGAAGG + Exonic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
915597011 1:156901721-156901743 ATGAGGCAGAGGCATATGGAGGG + Intronic
915612192 1:157003309-157003331 CTATGGCAAAGTCAAATGGATGG - Intronic
916119897 1:161520010-161520032 CTGTGTCCCAGGAAAATGGAAGG - Intronic
916129660 1:161601661-161601683 CTGTGTCCCAGGAAAATGGAAGG - Intronic
918038254 1:180896214-180896236 CTGGGGCAGAGGCACATGAATGG + Intergenic
918094931 1:181326612-181326634 CGGTGGCCAAGGCAAAGGGAGGG - Intergenic
919806504 1:201383830-201383852 CTGTGGGGGAGGGAAGGGGAGGG - Intronic
1063281555 10:4634641-4634663 CTGTGGCAGAGAAAAAGGGAAGG + Intergenic
1064242971 10:13647255-13647277 TTGTGAAGGAGGAAAATGGAAGG + Intronic
1064453898 10:15469047-15469069 CTTTGCAGGAGGCAGATGGAGGG - Intergenic
1067243711 10:44518119-44518141 CCTTGGAGGAGGCAGATGGAAGG + Intergenic
1068063614 10:52100995-52101017 CTGTGGCCAAGGCAATTTGATGG + Intronic
1071488658 10:86121055-86121077 ATGTTGTGGAGGGAAATGGAGGG - Intronic
1075089766 10:119437149-119437171 CTGGGATGGAGGCAACTGGAGGG - Intronic
1075437341 10:122454759-122454781 CTGAGGCGGAGGGGAAAGGAGGG + Exonic
1075489562 10:122854989-122855011 CTGTGGAGGAGGCACAGAGATGG - Intronic
1077140191 11:1020836-1020858 CTGTGGTGGAGGGGACTGGAGGG + Intronic
1082907180 11:58321251-58321273 CAGAGGGAGAGGCAAATGGATGG - Intergenic
1083681034 11:64351998-64352020 TTGTGGAGGAGGCAAAGGGCTGG - Intronic
1084887017 11:72217354-72217376 CTGTGGGGAAGGCAACTTGAAGG + Intronic
1086106974 11:83157219-83157241 CTGTGGCGGCTGGAAGTGGACGG + Exonic
1090409273 11:126496559-126496581 GTGTGATGGAGGCAAAGGGAAGG + Intronic
1092171435 12:6375974-6375996 CAGTGGTGGGGGCAAATAGAAGG + Intronic
1098913993 12:76238815-76238837 GTGGGGCGGTGGCAAAGGGAAGG - Intergenic
1102177293 12:110885584-110885606 CAGTGGCGGAGGGAAATGCATGG - Intronic
1103361352 12:120356267-120356289 CTTTGGAGGGGGCAAAAGGAAGG - Intronic
1104112488 12:125716941-125716963 CTGGGGCGCAGGCAGAGGGAAGG + Intergenic
1106190737 13:27450413-27450435 CTGTGGAGGAGGCACCCGGAAGG - Intronic
1109860583 13:68192729-68192751 CTGTTCTGGAGGCCAATGGAGGG + Intergenic
1113694764 13:112336684-112336706 CTGTGGTGGGGGCAGAGGGAGGG + Intergenic
1114169955 14:20262405-20262427 CAGTGGGGGAGGCAAATGATAGG - Intronic
1114231360 14:20785863-20785885 CTGTGGCTGAGGCAGGTGGCTGG + Intergenic
1114502870 14:23184117-23184139 GGGTGGGGGAGGGAAATGGAAGG + Intergenic
1119416771 14:74476165-74476187 TTGTGGCAGAGGCATATGGATGG + Intergenic
1121710825 14:96038353-96038375 CTGTGGCACAGGGAGATGGAGGG - Intergenic
1125129694 15:36268951-36268973 GTGTGGCAGAGGCACATGTAGGG + Intergenic
1127367827 15:58308239-58308261 CTGTCTGGGAGCCAAATGGAAGG + Intronic
1128133322 15:65245194-65245216 CTGTGGGGGAGGCACAGAGAGGG + Intronic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1131103090 15:89709249-89709271 CTGTGGCAGAGACAAAAGCAAGG + Intronic
1132550316 16:551320-551342 CTGTGGCGGGGGCAACATGAAGG + Exonic
1136119536 16:28122894-28122916 CTTTGGAGGAGGCAGATGAAAGG + Intronic
1137468823 16:48736172-48736194 CTGTGGCAGAGGAAAAGGCATGG + Intergenic
1140326372 16:74006619-74006641 TTGTGGAGGAGGCAAATGCCAGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1142687543 17:1586357-1586379 CTGTGACGGAGGCTAAGTGACGG + Intronic
1142716316 17:1748804-1748826 CTGTGGAGCAGGCACAGGGATGG + Intronic
1144812608 17:18010233-18010255 CTGTGGCAGAGGAGAATGCAGGG + Intronic
1146974066 17:37096151-37096173 GTGTGGAGGAGGGAATTGGAGGG - Intronic
1147178979 17:38673417-38673439 CTGTGGAGGTGGCAGATGGGGGG - Exonic
1149244575 17:54690457-54690479 CTGAGGCTGAGCCAAAAGGAGGG - Intergenic
1150290654 17:63979636-63979658 CAGGGGTGGAGGCAAGTGGAAGG - Intergenic
1154063272 18:11083469-11083491 CTGTGGCTTGGGGAAATGGAGGG + Intronic
1154512156 18:15118097-15118119 CTGGGGTGAAGGCAAATGAAGGG - Intergenic
1155986935 18:32239676-32239698 TTGTGGGGGAAGCAAAAGGATGG - Intronic
1157074760 18:44453458-44453480 CTGTGGAGGAGGCAGATTGACGG + Intergenic
1157366165 18:47066035-47066057 CTATGGTGGAGGGAACTGGATGG + Intronic
1159323320 18:66883402-66883424 GTGTGATGGAGGAAAATGGAGGG - Intergenic
1165856379 19:38881156-38881178 CTGAGGTGGAGACAGATGGACGG + Intronic
1167042731 19:47032261-47032283 CTGGGGCTGGGGCAGATGGAAGG - Exonic
1167525626 19:49982009-49982031 CTGTGGCTGACTCAAAGGGAGGG + Intronic
1167537748 19:50065801-50065823 CTGGGGCGGTGTCAACTGGAGGG + Intergenic
925240997 2:2327608-2327630 CTGTTCAGGAGGCAAATGAATGG - Intronic
926742732 2:16125931-16125953 CTGTGGTGGAGGCACAGGGCTGG - Intergenic
926872424 2:17437089-17437111 GTGGGGTGGAGGCAAATTGATGG + Intergenic
930014679 2:46962245-46962267 CTGTGTCGGAGGAGAATGTAAGG - Intronic
930741736 2:54838601-54838623 CTGTAGCAGAGGGAATTGGAAGG + Intronic
931165590 2:59744109-59744131 CTTTGGCCAAGGCAGATGGAGGG + Intergenic
931201324 2:60100202-60100224 CTGTGGCTGAGGCCAACGGATGG - Intergenic
931700997 2:64908938-64908960 GTGTGGGGGAGGCAGATGGGAGG + Intergenic
931878631 2:66542370-66542392 CTGTGGAGGAGGCAAAGGGCTGG + Intronic
931954062 2:67397877-67397899 CTGTGGCGGAGGCAAATGGATGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937024560 2:118687341-118687363 ATAGGGCGGAGGCAAATTGAGGG + Intergenic
938511720 2:131954864-131954886 CTGGGGTGAAGGCAAATGAAGGG - Intergenic
938606061 2:132894063-132894085 CAGTTGCTGAGGCAAAGGGACGG + Intronic
941707385 2:168674335-168674357 CTGTGGAAGAGGAAAAGGGATGG - Intronic
943903788 2:193473033-193473055 CTGTGGTGGGGACAACTGGAAGG + Intergenic
945907703 2:215613680-215613702 TTGTGGAGGAGGCAAATGCTGGG + Intergenic
947124937 2:226858825-226858847 TTGTGGCAGAGAGAAATGGAAGG - Intronic
948910978 2:241002519-241002541 GTGTGACGGAAGCAGATGGAAGG + Intronic
1168857410 20:1018478-1018500 CTGTGGAGCAGGTAACTGGAGGG - Intergenic
1169007729 20:2222705-2222727 GTGTGGCTGAGGCCAAGGGAGGG - Intergenic
1172226186 20:33306718-33306740 CAGTGCCAGAGGCAAAGGGAGGG + Intronic
1172647143 20:36477652-36477674 CTGAGGCTGAGGCAGGTGGAGGG - Intronic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1174370782 20:50085966-50085988 CGGTGGTGGAGGAAAGTGGATGG - Intronic
1174665528 20:52254347-52254369 CTGTGGCTGGGGCAGAAGGATGG - Intergenic
1175492343 20:59387695-59387717 CTGAGGCTGAGGCAGAAGGATGG + Intergenic
1175924293 20:62464534-62464556 CTGCGGCGGAGGCCAACGCAGGG - Exonic
1177979755 21:27897065-27897087 CTGGGGTGAAGGCAAATGAAGGG + Intergenic
1182520843 22:30883778-30883800 CGGTGGCGGAGGCAGGGGGACGG - Intronic
1182847892 22:33446616-33446638 ATGTGGCTGAGACAAATAGATGG + Intronic
1185285111 22:49996598-49996620 GTGTGGTGGAGGGAAATGCAAGG + Exonic
950440286 3:13006444-13006466 TTGTGGTGGGGGCACATGGAGGG + Intronic
950559588 3:13713970-13713992 CTGGGGTGGGGGCACATGGAAGG + Intergenic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
954135737 3:48581341-48581363 CTGTGGAGGAGGCAAGAGGGAGG + Intronic
954660199 3:52222987-52223009 CCATGGGGGAGGCAGATGGAGGG - Exonic
954759095 3:52861133-52861155 CTGAGGCGGAGGCTGATGGAGGG + Intronic
955437120 3:58913256-58913278 GGGTGGAGGTGGCAAATGGATGG + Intronic
959737471 3:109676334-109676356 CTATGGCAGAGTCAAATGGGGGG - Intergenic
960750226 3:120941754-120941776 CAGTGAAGGGGGCAAATGGAAGG + Intronic
966860248 3:184227710-184227732 CCTTAGCTGAGGCAAATGGAGGG - Intronic
967413267 3:189188520-189188542 ATGTGGAGGAGGAAAAGGGAAGG - Intronic
968741343 4:2333169-2333191 CTGCGGGGGAGGCCAAGGGAGGG - Intronic
969967072 4:11007990-11008012 CTGTGGAGGTGGCATTTGGATGG + Intergenic
970289075 4:14552071-14552093 CTGCGAGAGAGGCAAATGGAGGG + Intergenic
977805598 4:101293696-101293718 CTGTGGTGGAGGTGAAGGGAGGG - Intronic
980397929 4:132239658-132239680 ATGGGGCTGAGGCATATGGAAGG - Intergenic
984453797 4:179939060-179939082 GTATAGTGGAGGCAAATGGATGG + Intergenic
984702992 4:182830276-182830298 CTGTGCAGGAGGCAAAGGGCAGG - Intergenic
984847163 4:184117693-184117715 CTGTGGAGGAGACAAACAGAGGG + Intronic
985968229 5:3353767-3353789 CTTTGCAGGGGGCAAATGGATGG + Intergenic
988470226 5:31531000-31531022 CTGTTGCGGAGGTACATGGAAGG - Intronic
990124585 5:52498390-52498412 CAGTGCAGGTGGCAAATGGACGG + Intergenic
992864694 5:80946029-80946051 CTGTCGGGGAGGCAGAGGGAGGG - Intergenic
993215352 5:85015852-85015874 CTGTGGTGGGGGCACATGGCAGG + Intergenic
993226406 5:85170421-85170443 CTGTAACGGAGAGAAATGGAAGG - Intergenic
995029775 5:107466845-107466867 CTGGAGCTGGGGCAAATGGAAGG + Intronic
997229911 5:132234731-132234753 CCATGGGGGAGGCAAATGGTAGG - Intronic
998349965 5:141494084-141494106 CTGAGACGGAGAAAAATGGAAGG - Intronic
999935896 5:156485690-156485712 TTGTGGAGGAGGCAAATGCTGGG - Intronic
1002181994 5:177435437-177435459 CTGTGAGGGAGGCCAGTGGAGGG + Intronic
1004411216 6:15383126-15383148 AAGTGGGGAAGGCAAATGGATGG + Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1007215458 6:40234238-40234260 CTGTCGCAGAGCAAAATGGAAGG + Intergenic
1007684569 6:43657749-43657771 CTGAGGCACAGGGAAATGGAGGG - Intronic
1010368010 6:75075116-75075138 ATGTGGAGGAGGAAAATGAAGGG - Intergenic
1010995601 6:82528771-82528793 GGGAGGCGGAGGCAAAAGGATGG + Intergenic
1012247153 6:96938566-96938588 CTGTGGAGGAGGCCAGTGGCTGG - Intronic
1014959399 6:127663940-127663962 CTGTGGAGAATGCAAAAGGATGG + Intergenic
1019384512 7:746936-746958 CTGTGTCGGAGGCTCATGCATGG + Intronic
1019833163 7:3354095-3354117 CTGAGGCTGAGGCAAAAGAATGG - Intronic
1021234420 7:18124731-18124753 CTGGGGGCAAGGCAAATGGAAGG - Intronic
1021281990 7:18731449-18731471 CTGTGGAGGATGCACATGGATGG - Intronic
1022799464 7:33761842-33761864 CTGTGCTGGAGGCAAATGGGAGG + Intergenic
1023695259 7:42838960-42838982 CCATGGCAGAGGCAAATGGGTGG + Intergenic
1030541994 7:110842574-110842596 CTTTGGGGGAGGCAGAAGGAGGG + Intronic
1030915372 7:115305422-115305444 CTGTGAAGGATGTAAATGGAAGG - Intergenic
1035184105 7:157112316-157112338 CTGTGGAGGAGACAAAGTGAGGG + Intergenic
1035272706 7:157729848-157729870 CTGTGGCCCAGTCAAATGGACGG - Intronic
1035433133 7:158837389-158837411 CTGTGGAGGGGCCACATGGAAGG - Intergenic
1039385515 8:37132085-37132107 CTGTGGAGGAGGCAGGTGGCGGG - Intergenic
1041771206 8:61474345-61474367 CTGTGGTGGAGTCACATGGGTGG + Intronic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1042958213 8:74274533-74274555 CAGTGGAGGAGGCAAAAGGGAGG - Intronic
1044392660 8:91670105-91670127 CTGTAGCATAGGTAAATGGAAGG + Intergenic
1045724889 8:105160765-105160787 CAGTGGCGGGGGCAAGGGGAAGG - Intronic
1046671415 8:117060628-117060650 CTCTGGAGTAGGGAAATGGAAGG - Intronic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048973275 8:139656997-139657019 GTGTGGAGGGGGCAAATGGTGGG - Intronic
1049354484 8:142180874-142180896 ATGTGGGGGAGGCAAAGGGGAGG - Intergenic
1051577283 9:18631218-18631240 TTCTGGCCTAGGCAAATGGAAGG + Intronic
1052888832 9:33677000-33677022 CGGCGGCGGCGGCACATGGAGGG - Intergenic
1053314099 9:37037314-37037336 CTGTGGGGAAGGCAAATTGGAGG + Intergenic
1054206127 9:62131476-62131498 CTGAGGAAGAGGCAAAGGGAGGG - Intergenic
1054632231 9:67456891-67456913 CTGAGGAAGAGGCAAAGGGAGGG + Intergenic
1055481225 9:76710825-76710847 CGGTGGCGGAGGAACATGCATGG - Exonic
1057848309 9:98543205-98543227 CTGTGGCTGAGGCTGAGGGAAGG - Intronic
1057885715 9:98828099-98828121 CTGTGGAGCAGGCAAAGGGCTGG + Intronic
1058223825 9:102336411-102336433 CTGTGGAGAAGGGAAATGGGAGG - Intergenic
1062068088 9:134539768-134539790 CTGTGGCCGAGGGAGAAGGATGG + Intergenic
1189028553 X:37426328-37426350 GTGTGGAGGAAGCTAATGGATGG + Intronic
1189437075 X:41002394-41002416 GTGTGGGGAAGACAAATGGATGG - Intergenic
1190026724 X:46930738-46930760 CTGTGATGGGGGCAAATGGATGG - Intronic
1192502323 X:71662279-71662301 GGGTGGCGGAGCCAAAGGGAAGG - Intergenic
1194262489 X:91714817-91714839 CTGTGGCTGAGGCAAAGGAAGGG - Intergenic
1195430398 X:104782792-104782814 CTGTTGCTGAGGCAAAGGGTTGG + Intronic
1195455506 X:105064767-105064789 CTGAGGAGGAGGAAAAGGGAAGG + Intronic
1195764723 X:108283881-108283903 CTGTGGGGGAGGAAGATTGATGG + Intronic
1199690161 X:150303635-150303657 CCGTGGTGGAGGCAATTGGGTGG - Intergenic
1200032856 X:153310483-153310505 GTGTGGGGGAGGCACATGCATGG - Intergenic
1200581780 Y:4959707-4959729 CTGTGGCTGAGGCAAAGGAAGGG - Intergenic