ID: 931954081

View in Genome Browser
Species Human (GRCh38)
Location 2:67397958-67397980
Sequence ACTCCACCACTGCTGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931954081_931954085 22 Left 931954081 2:67397958-67397980 CCAGTCAGCAGCAGTGGTGGAGT 0: 1
1: 0
2: 2
3: 16
4: 164
Right 931954085 2:67398003-67398025 CGCTAACCTCAGTTTTTGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 42
931954081_931954082 -3 Left 931954081 2:67397958-67397980 CCAGTCAGCAGCAGTGGTGGAGT 0: 1
1: 0
2: 2
3: 16
4: 164
Right 931954082 2:67397978-67398000 AGTGAGAAGAAACAGCTGATAGG 0: 1
1: 0
2: 1
3: 23
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931954081 Original CRISPR ACTCCACCACTGCTGCTGAC TGG (reversed) Intronic
900410898 1:2512185-2512207 CCTCCTCCAATGCTCCTGACAGG + Intronic
900493119 1:2962744-2962766 CCTCCAGCACAGCTGCTGAGAGG + Intergenic
901594609 1:10374995-10375017 ACTCCACCTGTGCTGTGGACAGG - Exonic
901600874 1:10422506-10422528 AATTCACCACTGGTGCTGAGAGG - Intergenic
902830078 1:19006838-19006860 ACTCCCCCATTGCAGCTCACAGG + Intergenic
902925233 1:19691587-19691609 ACTCCACCACTGCATCTCAATGG - Intronic
903768681 1:25750514-25750536 TCACCTCCACTGCTGCTGTCTGG + Intronic
910360619 1:86411155-86411177 AGTCCCCCACTGCTGGTGGCTGG - Intergenic
910525429 1:88172604-88172626 AATCCACCTCTTCTGCTGCCAGG + Intergenic
910921588 1:92354071-92354093 TCACCACCACTGCTGCTGCTTGG - Intronic
911182517 1:94873968-94873990 AATCCTCCACCCCTGCTGACTGG + Intronic
912300527 1:108511419-108511441 ACTTCACCTCTGTGGCTGACTGG + Intergenic
913564241 1:120055998-120056020 ACTCCTCTACTGTTGTTGACTGG + Intronic
913633886 1:120737566-120737588 ACTCCTCTACTGTTGTTGACTGG - Intergenic
914284828 1:146215347-146215369 ACTCCTCTACTGTTGTTGACTGG + Intronic
914402936 1:147340763-147340785 ACTCCACCTTTGTGGCTGACTGG + Intergenic
914415921 1:147482049-147482071 AGACCACCACTTCTCCTGACAGG - Intergenic
914545859 1:148666086-148666108 ACTCCTCTACTGTTGTTGACTGG + Intronic
914620704 1:149404580-149404602 ACTCCTCTACTGTTGTTGACTGG - Intergenic
915685256 1:157625875-157625897 TCTCCACATCTGCTGCTGATGGG + Intergenic
919782373 1:201229211-201229233 CCTCCAGCCCTGCTGCTCACAGG - Intergenic
919944524 1:202309618-202309640 GCTGCACCACTGCTGCTGCATGG - Intronic
920030905 1:203036801-203036823 TCCCCAACACTGCTGCTGCCAGG - Intronic
920116151 1:203623306-203623328 ACCCCAGCTCTGCTGCAGACAGG - Intergenic
922762627 1:228142133-228142155 ACACCACCACCGCTGGAGACAGG - Intronic
924534311 1:244921155-244921177 ACTCCACCACTGCAGCTGGCAGG - Intergenic
924730242 1:246704374-246704396 ACTGCACCACTGCTCCAGCCTGG + Intergenic
1064083043 10:12323855-12323877 ACTCCACTTCTGCTTCTGACTGG + Intergenic
1064194405 10:13233651-13233673 ACCCCCACACTGCTGGTGACAGG - Intronic
1068127910 10:52864676-52864698 AGTCCACCACAGCTGCAGCCCGG - Intergenic
1068773390 10:60846936-60846958 ACTCCACCACTGCAGCTATAAGG - Intergenic
1069569624 10:69486482-69486504 ACTGCACCACTGCTCCAGCCTGG - Intronic
1073684967 10:105742264-105742286 ATTCTGTCACTGCTGCTGACTGG + Intergenic
1074012160 10:109493309-109493331 ACTGCACCACTGCTCCTCAATGG + Intergenic
1077368282 11:2170078-2170100 CCACCACCACTGCTTCTGACTGG - Intronic
1079345361 11:19647022-19647044 ACTCCACCTCTGCTTGTGGCAGG - Intronic
1080394612 11:31878378-31878400 ACACCAGCTCTGCTTCTGACTGG + Intronic
1084670044 11:70600699-70600721 ATTCCACCAATGCTGCTGGAAGG + Intronic
1092154524 12:6273804-6273826 ACTTCTCCGCTGCTTCTGACGGG - Intergenic
1092168318 12:6356830-6356852 AGTCCTCCTCTGCTGCTCACTGG - Intronic
1095314545 12:40744127-40744149 CCTCTACCCCTGCTACTGACAGG - Intronic
1098236744 12:68424833-68424855 ACTCCCTCACTGGTGCTCACGGG + Intergenic
1102458759 12:113087369-113087391 ACTCCTCCTCAGCTGCTGTCTGG - Intronic
1102659922 12:114517166-114517188 ACCCCAGCCCTGCGGCTGACTGG + Intergenic
1102924500 12:116816325-116816347 ACCCCACTGCTGCTGTTGACAGG + Intronic
1104442814 12:128808733-128808755 AATCCACAACTGCTGCAGTCGGG + Intronic
1104744965 12:131204784-131204806 GCTCCACTTCTGCTGTTGACAGG + Intergenic
1104789439 12:131472616-131472638 GGTCCACTTCTGCTGCTGACAGG - Intergenic
1105889059 13:24669042-24669064 ACTCCACCTCTCCTGGTGTCTGG - Intergenic
1105956883 13:25291842-25291864 ACTCAGCTACTGCTGCTAACAGG - Intergenic
1107106049 13:36643946-36643968 TCACCACCACTTCTGCTGTCAGG + Intergenic
1108434100 13:50384900-50384922 TCTCCACCCCTGCTGCAGAGAGG + Intronic
1111146709 13:84191368-84191390 CCTCCTCCACTGCTGCAGTCTGG + Intergenic
1111451539 13:88424640-88424662 ACTCCATGACTACTCCTGACAGG + Intergenic
1114652856 14:24297318-24297340 ACTCCACCAATGCTCCTGGTTGG + Intronic
1116040061 14:39675194-39675216 ACTCAACCACTGCTACTTCCAGG - Intergenic
1118764765 14:68902381-68902403 CCTCCACCTCTCCTGGTGACAGG - Intronic
1119854773 14:77891307-77891329 GCTGCTCCACAGCTGCTGACAGG - Intronic
1121078134 14:91086024-91086046 ATGCCACCACTGGGGCTGACAGG - Intronic
1121858051 14:97288623-97288645 ACTCTGCCATTGCTTCTGACTGG + Intergenic
1122150675 14:99724557-99724579 ACCCCACCTCTGCTCCTGGCTGG + Intronic
1122208979 14:100162737-100162759 ACCCCACCCCTGCTGCTGCCTGG - Intergenic
1130650230 15:85758272-85758294 ACTTCACCTCTGCTGCTGTCTGG + Intergenic
1131419884 15:92296417-92296439 GGTCCACCACTACAGCTGACTGG + Intergenic
1132198614 15:99932501-99932523 ACACCACCACTTCTGCTTTCAGG - Intergenic
1132462011 16:60196-60218 ACCCCCCCACTGCAGCTCACCGG + Exonic
1132581431 16:686450-686472 GCTCCACCGCTGCTGGTGCCTGG + Intronic
1133507779 16:6429312-6429334 TCCCCACCACTGCTGCTGCAGGG + Intronic
1134106264 16:11487573-11487595 ACACACCCACTTCTGCTGACAGG + Intronic
1139711326 16:68778754-68778776 ACTGCACCGTTTCTGCTGACAGG - Intronic
1142000572 16:87661928-87661950 ACGCCACCACTACTCCTGAGTGG + Intronic
1142202381 16:88767479-88767501 ACTCCCCCACTGCAGGTGACTGG + Intronic
1142301257 16:89259497-89259519 ACTGCACCACTGCTCCAGTCTGG - Intergenic
1143166004 17:4897610-4897632 CTTACCCCACTGCTGCTGACTGG + Exonic
1147547900 17:41417425-41417447 ACTTCAGCACTGCTGGTGGCTGG - Intergenic
1149304642 17:55335865-55335887 CCTCCACCACTGCTGCACACAGG - Intergenic
1152036462 17:77876114-77876136 ACTCCACCAGGGCTGTTGACTGG - Intergenic
1155095955 18:22556852-22556874 GCTCTACCACTGCTCCTGCCTGG + Intergenic
1155173398 18:23283426-23283448 ACTGCACCACTGCTCCAGCCTGG + Intronic
1157751154 18:50179665-50179687 AATGCACCCCTGCTGCTGATGGG + Intronic
1161526961 19:4762086-4762108 CCTCCACCACTGTGGCTGCCAGG + Intergenic
1162668783 19:12237515-12237537 GCTCCACCACAGCTTCTGTCCGG - Intronic
1163054204 19:14706149-14706171 ACTCCAGTTCTGCTCCTGACAGG + Intronic
1166235217 19:41450810-41450832 ACACCACCATTCCTGCTGATGGG - Intergenic
1167066530 19:47190475-47190497 CCCCCTCCACTGCTGCTAACTGG + Intronic
926885668 2:17596280-17596302 ACCACAGCACTGCTGCTGATAGG + Intronic
926991805 2:18688232-18688254 ACACCACCACTGCTGGGGTCGGG + Intergenic
928285673 2:29988088-29988110 ACTCCCCTACTGCTGCTTCCTGG + Intergenic
930017888 2:46983436-46983458 ACTCCCCCACGGCTGCTGCTTGG + Intronic
931954081 2:67397958-67397980 ACTCCACCACTGCTGCTGACTGG - Intronic
936655928 2:114487356-114487378 AATCCACCACAGAAGCTGACAGG - Intronic
936993864 2:118393577-118393599 ACCCTACTAGTGCTGCTGACCGG + Intergenic
937481211 2:122261481-122261503 ACTCCATCTCTGCTGCTGACTGG + Intergenic
939059680 2:137405638-137405660 ATTCCATCATTTCTGCTGACCGG - Exonic
940396619 2:153197810-153197832 CCCTCACCACTGCTGCTGCCTGG - Intergenic
941290841 2:163672486-163672508 ACTCCTCCAATGCTACTGAAGGG + Intronic
942882774 2:180883021-180883043 ATCCCACCACTGCTGCTGCAGGG + Intergenic
944862294 2:203826455-203826477 CCACCACCACTGCTGTTGAAGGG + Intergenic
945406168 2:209451473-209451495 ACCCCACCACAGCTACTGCCAGG - Intronic
946823469 2:223653559-223653581 CCTCACCCACTTCTGCTGACAGG + Intergenic
1168730069 20:69413-69435 GCTCCACCACTGCTGCTTTTTGG - Intergenic
1169006515 20:2211821-2211843 AGTCCAACAATGTTGCTGACTGG - Intergenic
1169711553 20:8570279-8570301 ACTCCACCACTGTTGCAGAGGGG - Intronic
1170457591 20:16547878-16547900 TCTCCAGCTCTGCTGCTCACAGG + Intronic
1171463240 20:25310414-25310436 ACTCCACCTTTGCTGGAGACTGG - Intronic
1173836987 20:46132391-46132413 TCTCCACCACTGGTGCTTCCCGG + Intergenic
1174215337 20:48912052-48912074 ACTCTTCCACTGCTGCTTCCTGG - Intergenic
1175749058 20:61482613-61482635 GCTGCACCGCTTCTGCTGACAGG + Intronic
1175915763 20:62424986-62425008 GCCCCACCAGGGCTGCTGACTGG - Intronic
1177974019 21:27825239-27825261 GCACCGCCACTGCTGCTGAGCGG - Intergenic
1178581143 21:33839538-33839560 ACTCAACCACTGCTCCACACGGG - Intronic
1180230518 21:46424323-46424345 CCACCACCACCACTGCTGACAGG + Intronic
1184665063 22:45984015-45984037 CCTCCACCACTGCTACCTACAGG + Intergenic
950697565 3:14715170-14715192 ACTCCACCACTCCTCCAGCCTGG + Intronic
952879342 3:37973603-37973625 ACTGCACCACTACTGCTGGCTGG - Intronic
956249428 3:67220054-67220076 ACTCCACCACTCCTGGTCTCTGG + Intergenic
959169803 3:102830814-102830836 ACCCTGCCACTGCTGCTGGCAGG + Intergenic
961495715 3:127289419-127289441 ACGCCACCACTCCTGCTAATTGG + Intergenic
963466848 3:145692885-145692907 ACTCTACCACTGCTGCTATCTGG + Intergenic
963890497 3:150631165-150631187 ATTGCACCACTGCAGGTGACAGG + Intergenic
967311147 3:188107483-188107505 ACTCCCCCACTCCTGCTGTAAGG + Intergenic
967315266 3:188146624-188146646 GATCCACCACTGCAGCTGAGAGG - Intergenic
967390925 3:188953436-188953458 ACACCCCCACTGCTCATGACTGG + Intronic
968519014 4:1027378-1027400 GCCCCACCCCTCCTGCTGACCGG - Intergenic
969683011 4:8653549-8653571 ACTCCACCCCTGCTGCAGGAGGG - Intergenic
970352175 4:15213376-15213398 ACTCTTCCACTGCTGTTAACAGG + Intergenic
973789468 4:54364978-54365000 ACTCCCTCACTTCTGCTTACTGG + Intergenic
978676804 4:111327775-111327797 ACCCTGCCACTGCTGCTGAGGGG + Intergenic
979547670 4:121955720-121955742 ATCCCACCTCTGCTGCTCACAGG + Intergenic
979678693 4:123435918-123435940 GCTCCACCATTGCTGGTGAGAGG - Intergenic
985717414 5:1470387-1470409 ACTCCCCCAGTGGTGATGACTGG + Intronic
985955983 5:3266818-3266840 TCTCCAGCACTGCTGTTGGCTGG - Intergenic
987224075 5:15821470-15821492 ATTCCACCCCTGCTGCTGAATGG + Intronic
990613338 5:57482087-57482109 ACTTCACCACCACTGCTGAGCGG - Exonic
990796332 5:59545289-59545311 AACCCAGCACTGTTGCTGACTGG - Intronic
995367591 5:111381068-111381090 ATTCCAACACAGCAGCTGACAGG - Intronic
995991689 5:118247488-118247510 ACAACACCACTGCTGCTACCAGG + Intergenic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
1002771889 6:297096-297118 CCTCCACCACTGCTGCTTCATGG + Intronic
1003017533 6:2480017-2480039 ACTCCTCCACTCCTGCCCACAGG + Intergenic
1005944687 6:30586676-30586698 ACGCTACTCCTGCTGCTGACTGG + Exonic
1006350912 6:33520490-33520512 ACTAAATCACTGCTGCTGCCAGG - Intergenic
1006839243 6:37017800-37017822 GCCCCACCCCTGCTCCTGACTGG + Intronic
1007419103 6:41708625-41708647 ACTCTACCACTGGTGCTCCCTGG + Intronic
1008017715 6:46540808-46540830 ATCACACCACTGCTGCTGGCAGG - Intergenic
1009673583 6:66788125-66788147 CCGCCATCACTGCTGCTGCCAGG + Intergenic
1009879031 6:69541820-69541842 AGTGCACCACTTCTGCTGACAGG + Intergenic
1016130805 6:140467218-140467240 ACTCCACCACTGCTTGGGGCAGG + Intergenic
1016453640 6:144209584-144209606 GCTTCACCACTGCTGCTGGCAGG - Intergenic
1018369713 6:163156495-163156517 CCTCTTCCACTGCTGCTGCCTGG + Intronic
1019491301 7:1314782-1314804 ACTCCACCACAGCTGGAGGCAGG - Intergenic
1024548185 7:50539506-50539528 TCTCCACCAGGGCTGCTGCCTGG - Intronic
1026679165 7:72452262-72452284 ACTGTACCACTGCTGCAGATGGG - Intergenic
1029424951 7:100489293-100489315 CCTCCACCACCGCGGCTGCCTGG + Exonic
1032021617 7:128409864-128409886 ACTCCACCACCGCTGCAGGGAGG - Exonic
1032728777 7:134616943-134616965 ACTCCACCACAGATGCAGACAGG + Intergenic
1035683902 8:1508696-1508718 AATCCACAACTGCTGCGCACAGG + Intronic
1035853352 8:2944363-2944385 GCTGCACCACTGCTGCTGCTGGG - Intronic
1037551136 8:19972811-19972833 ACTCCACCCATTCCGCTGACAGG + Intergenic
1038215479 8:25558219-25558241 ACTGCAGCACTGCAGCTGAGAGG + Intergenic
1038563938 8:28603975-28603997 GCTCCACCACTGCTGCAGGGTGG - Intronic
1039796780 8:40922627-40922649 CCTCACCCACTGCTGCTGATGGG - Intergenic
1040991185 8:53352217-53352239 CCTCCACAACTCCTGCTGAGAGG - Intergenic
1042228051 8:66530314-66530336 ACTCCAGCACTGCTCCTGCATGG + Intergenic
1043290041 8:78587375-78587397 ACGTCAGTACTGCTGCTGACTGG + Intronic
1044346887 8:91115423-91115445 AATCCACCAGTGCTGGGGACTGG - Intronic
1045555576 8:103211837-103211859 ACTCCTCTATTGTTGCTGACTGG + Intronic
1046135532 8:110021217-110021239 ACTCCAACTCTGCCACTGACTGG + Intergenic
1047028318 8:120848956-120848978 ACAGCAACACTGCTGCTGAATGG - Intergenic
1048998050 8:139806311-139806333 ATACCACCACTGCTGCGCACAGG - Intronic
1049270605 8:141693681-141693703 TCTCCACCTCTGCTGCCCACCGG - Intergenic
1049815315 8:144596422-144596444 GCTCCACCACTGCTCCTGTCTGG + Intronic
1054931196 9:70637151-70637173 TCTACACCTCTGCTGCTTACTGG + Intronic
1055563283 9:77543152-77543174 ACACCACTTCTGCTGCTGCCAGG - Intronic
1056063187 9:82906326-82906348 GGTCCACCTGTGCTGCTGACTGG + Intergenic
1059875440 9:118629260-118629282 TTTCCACCACTGCTGCTGATGGG - Intergenic
1060335290 9:122716395-122716417 CCTCCACCCCTGCTGCTGCATGG + Intergenic
1061357810 9:130119565-130119587 ATTCCAACTCTGCTGCTCACTGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1199517983 X:148700341-148700363 ACTCCACCACTTCGGGTGCCTGG - Intronic
1199694720 X:150335701-150335723 GCTCCCCAACTGCTGCTGAAGGG - Intergenic
1200055321 X:153457031-153457053 ACTCCCCCTCTGATGCTGGCTGG - Intronic
1200674574 Y:6135137-6135159 ACCCCACCCCTGCTGCTCTCAGG + Intergenic