ID: 931957309

View in Genome Browser
Species Human (GRCh38)
Location 2:67441711-67441733
Sequence CAAAGTTAGCAGCTTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931957309_931957314 -9 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957314 2:67441725-67441747 CTAACTTTGTCTGGTGTTGGGGG No data
931957309_931957317 -2 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957317 2:67441732-67441754 TGTCTGGTGTTGGGGGATCGGGG No data
931957309_931957321 30 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957321 2:67441764-67441786 TTCTAAGTGAAGTGTCATCGCGG No data
931957309_931957319 6 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957319 2:67441740-67441762 GTTGGGGGATCGGGGAAGGAAGG No data
931957309_931957315 -4 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957315 2:67441730-67441752 TTTGTCTGGTGTTGGGGGATCGG No data
931957309_931957316 -3 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957316 2:67441731-67441753 TTGTCTGGTGTTGGGGGATCGGG No data
931957309_931957320 7 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957320 2:67441741-67441763 TTGGGGGATCGGGGAAGGAAGGG No data
931957309_931957318 2 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957318 2:67441736-67441758 TGGTGTTGGGGGATCGGGGAAGG No data
931957309_931957313 -10 Left 931957309 2:67441711-67441733 CCAAGCACAAGCTGCTAACTTTG No data
Right 931957313 2:67441724-67441746 GCTAACTTTGTCTGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931957309 Original CRISPR CAAAGTTAGCAGCTTGTGCT TGG (reversed) Intergenic
No off target data available for this crispr