ID: 931965433

View in Genome Browser
Species Human (GRCh38)
Location 2:67528671-67528693
Sequence GTGCAGGTTAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931965433_931965435 -3 Left 931965433 2:67528671-67528693 CCTCAATTTGCATTAACCTGCAC No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965433_931965438 4 Left 931965433 2:67528671-67528693 CCTCAATTTGCATTAACCTGCAC No data
Right 931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG No data
931965433_931965437 3 Left 931965433 2:67528671-67528693 CCTCAATTTGCATTAACCTGCAC No data
Right 931965437 2:67528697-67528719 AATTTGCATATAATTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931965433 Original CRISPR GTGCAGGTTAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr