ID: 931965435

View in Genome Browser
Species Human (GRCh38)
Location 2:67528691-67528713
Sequence CACCTTAATTTGCATATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931965432_931965435 -2 Left 931965432 2:67528670-67528692 CCCTCAATTTGCATTAACCTGCA No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965431_931965435 4 Left 931965431 2:67528664-67528686 CCTTTGCCCTCAATTTGCATTAA No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965427_931965435 30 Left 931965427 2:67528638-67528660 CCCCTTTCCTAGAAAGTTCTAAG No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965430_931965435 23 Left 931965430 2:67528645-67528667 CCTAGAAAGTTCTAAGTAACCTT No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965429_931965435 28 Left 931965429 2:67528640-67528662 CCTTTCCTAGAAAGTTCTAAGTA No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965428_931965435 29 Left 931965428 2:67528639-67528661 CCCTTTCCTAGAAAGTTCTAAGT No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data
931965433_931965435 -3 Left 931965433 2:67528671-67528693 CCTCAATTTGCATTAACCTGCAC No data
Right 931965435 2:67528691-67528713 CACCTTAATTTGCATATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931965435 Original CRISPR CACCTTAATTTGCATATAAT TGG Intergenic
No off target data available for this crispr