ID: 931965438

View in Genome Browser
Species Human (GRCh38)
Location 2:67528698-67528720
Sequence ATTTGCATATAATTGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931965431_931965438 11 Left 931965431 2:67528664-67528686 CCTTTGCCCTCAATTTGCATTAA No data
Right 931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG No data
931965432_931965438 5 Left 931965432 2:67528670-67528692 CCCTCAATTTGCATTAACCTGCA No data
Right 931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG No data
931965433_931965438 4 Left 931965433 2:67528671-67528693 CCTCAATTTGCATTAACCTGCAC No data
Right 931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG No data
931965430_931965438 30 Left 931965430 2:67528645-67528667 CCTAGAAAGTTCTAAGTAACCTT No data
Right 931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931965438 Original CRISPR ATTTGCATATAATTGGAAAT GGG Intergenic
No off target data available for this crispr