ID: 931968865

View in Genome Browser
Species Human (GRCh38)
Location 2:67564184-67564206
Sequence GAATAGTCTAAGCCATAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931968863_931968865 20 Left 931968863 2:67564141-67564163 CCTCAGAAAGTCTGCTTTAATAG No data
Right 931968865 2:67564184-67564206 GAATAGTCTAAGCCATAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931968865 Original CRISPR GAATAGTCTAAGCCATAGTG TGG Intergenic
No off target data available for this crispr