ID: 931969845

View in Genome Browser
Species Human (GRCh38)
Location 2:67573892-67573914
Sequence CAGGAAGAAGCCCTGCACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931969845_931969852 23 Left 931969845 2:67573892-67573914 CCTATGTGCAGGGCTTCTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 931969852 2:67573938-67573960 AACTGTCTCTAGTTTTGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 129
931969845_931969851 18 Left 931969845 2:67573892-67573914 CCTATGTGCAGGGCTTCTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 931969851 2:67573933-67573955 TTGGAAACTGTCTCTAGTTTTGG 0: 1
1: 0
2: 1
3: 27
4: 257
931969845_931969848 -8 Left 931969845 2:67573892-67573914 CCTATGTGCAGGGCTTCTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 931969848 2:67573907-67573929 TCTTCCTGGGTGTAACAATAAGG 0: 1
1: 0
2: 0
3: 12
4: 95
931969845_931969850 -1 Left 931969845 2:67573892-67573914 CCTATGTGCAGGGCTTCTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 931969850 2:67573914-67573936 GGGTGTAACAATAAGGAATTTGG 0: 1
1: 0
2: 0
3: 16
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931969845 Original CRISPR CAGGAAGAAGCCCTGCACAT AGG (reversed) Intergenic