ID: 931969849

View in Genome Browser
Species Human (GRCh38)
Location 2:67573911-67573933
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931969849_931969852 4 Left 931969849 2:67573911-67573933 CCTGGGTGTAACAATAAGGAATT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 931969852 2:67573938-67573960 AACTGTCTCTAGTTTTGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 129
931969849_931969851 -1 Left 931969849 2:67573911-67573933 CCTGGGTGTAACAATAAGGAATT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 931969851 2:67573933-67573955 TTGGAAACTGTCTCTAGTTTTGG 0: 1
1: 0
2: 1
3: 27
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931969849 Original CRISPR AATTCCTTATTGTTACACCC AGG (reversed) Intergenic