ID: 931969852

View in Genome Browser
Species Human (GRCh38)
Location 2:67573938-67573960
Sequence AACTGTCTCTAGTTTTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931969849_931969852 4 Left 931969849 2:67573911-67573933 CCTGGGTGTAACAATAAGGAATT 0: 1
1: 0
2: 1
3: 9
4: 110
Right 931969852 2:67573938-67573960 AACTGTCTCTAGTTTTGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 129
931969845_931969852 23 Left 931969845 2:67573892-67573914 CCTATGTGCAGGGCTTCTTCCTG 0: 1
1: 0
2: 0
3: 21
4: 240
Right 931969852 2:67573938-67573960 AACTGTCTCTAGTTTTGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931969852 Original CRISPR AACTGTCTCTAGTTTTGGCC TGG Intergenic