ID: 931973461

View in Genome Browser
Species Human (GRCh38)
Location 2:67616174-67616196
Sequence CTGGGAACTCAGAAGGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931973454_931973461 5 Left 931973454 2:67616146-67616168 CCACGTTGACTTCCAGAGCCACA No data
Right 931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG No data
931973457_931973461 -7 Left 931973457 2:67616158-67616180 CCAGAGCCACATCCAGCTGGGAA No data
Right 931973461 2:67616174-67616196 CTGGGAACTCAGAAGGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931973461 Original CRISPR CTGGGAACTCAGAAGGAACT AGG Intergenic
No off target data available for this crispr