ID: 931974761

View in Genome Browser
Species Human (GRCh38)
Location 2:67630834-67630856
Sequence GTGAGAAGGACTAAATCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931974754_931974761 23 Left 931974754 2:67630788-67630810 CCTTCTGTTTTAACTGAACAAAG No data
Right 931974761 2:67630834-67630856 GTGAGAAGGACTAAATCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931974761 Original CRISPR GTGAGAAGGACTAAATCTAG GGG Intergenic
No off target data available for this crispr