ID: 931975301

View in Genome Browser
Species Human (GRCh38)
Location 2:67637634-67637656
Sequence CAGCCATATTCACCTCCGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931975293_931975301 18 Left 931975293 2:67637593-67637615 CCACTTTCCTCAGTACCAGACCC No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data
931975298_931975301 -6 Left 931975298 2:67637617-67637639 CCTTACATCTTGTCCTCCAGCCA No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data
931975297_931975301 -3 Left 931975297 2:67637614-67637636 CCACCTTACATCTTGTCCTCCAG No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data
931975292_931975301 25 Left 931975292 2:67637586-67637608 CCTCTAGCCACTTTCCTCAGTAC No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data
931975296_931975301 -2 Left 931975296 2:67637613-67637635 CCCACCTTACATCTTGTCCTCCA No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data
931975294_931975301 11 Left 931975294 2:67637600-67637622 CCTCAGTACCAGACCCACCTTAC No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data
931975295_931975301 3 Left 931975295 2:67637608-67637630 CCAGACCCACCTTACATCTTGTC No data
Right 931975301 2:67637634-67637656 CAGCCATATTCACCTCCGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931975301 Original CRISPR CAGCCATATTCACCTCCGTG TGG Intergenic
No off target data available for this crispr