ID: 931975632

View in Genome Browser
Species Human (GRCh38)
Location 2:67640982-67641004
Sequence GGTCTGAAGAGACCCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931975632_931975634 1 Left 931975632 2:67640982-67641004 CCAGCTTTGGGTCTCTTCAGACC No data
Right 931975634 2:67641006-67641028 CACATCATGAGATATAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931975632 Original CRISPR GGTCTGAAGAGACCCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr