ID: 931980023

View in Genome Browser
Species Human (GRCh38)
Location 2:67684935-67684957
Sequence GGAGCTATAATGCTCCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931980023_931980025 -3 Left 931980023 2:67684935-67684957 CCATTAAGGAGCATTATAGCTCC No data
Right 931980025 2:67684955-67684977 TCCTTAGCTTAATAGAGAGAGGG No data
931980023_931980028 -1 Left 931980023 2:67684935-67684957 CCATTAAGGAGCATTATAGCTCC No data
Right 931980028 2:67684957-67684979 CTTAGCTTAATAGAGAGAGGGGG No data
931980023_931980029 0 Left 931980023 2:67684935-67684957 CCATTAAGGAGCATTATAGCTCC No data
Right 931980029 2:67684958-67684980 TTAGCTTAATAGAGAGAGGGGGG No data
931980023_931980024 -4 Left 931980023 2:67684935-67684957 CCATTAAGGAGCATTATAGCTCC No data
Right 931980024 2:67684954-67684976 CTCCTTAGCTTAATAGAGAGAGG No data
931980023_931980027 -2 Left 931980023 2:67684935-67684957 CCATTAAGGAGCATTATAGCTCC No data
Right 931980027 2:67684956-67684978 CCTTAGCTTAATAGAGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931980023 Original CRISPR GGAGCTATAATGCTCCTTAA TGG (reversed) Intergenic