ID: 931980025

View in Genome Browser
Species Human (GRCh38)
Location 2:67684955-67684977
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931980023_931980025 -3 Left 931980023 2:67684935-67684957 CCATTAAGGAGCATTATAGCTCC No data
Right 931980025 2:67684955-67684977 TCCTTAGCTTAATAGAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr