ID: 931981681

View in Genome Browser
Species Human (GRCh38)
Location 2:67699902-67699924
Sequence CTCGCTCCTGGCCCATGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931981677_931981681 12 Left 931981677 2:67699867-67699889 CCCTCCACTGCTGCAACTCACAC No data
Right 931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG No data
931981679_931981681 8 Left 931981679 2:67699871-67699893 CCACTGCTGCAACTCACACTGAA No data
Right 931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG No data
931981676_931981681 20 Left 931981676 2:67699859-67699881 CCTCAAAACCCTCCACTGCTGCA No data
Right 931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG No data
931981678_931981681 11 Left 931981678 2:67699868-67699890 CCTCCACTGCTGCAACTCACACT No data
Right 931981681 2:67699902-67699924 CTCGCTCCTGGCCCATGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931981681 Original CRISPR CTCGCTCCTGGCCCATGAAC TGG Intergenic
No off target data available for this crispr