ID: 931984047

View in Genome Browser
Species Human (GRCh38)
Location 2:67724422-67724444
Sequence CCACCTGCCCAAAGCGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931984038_931984047 27 Left 931984038 2:67724372-67724394 CCATTTCAGCTGCTTCCCTCCAG No data
Right 931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG No data
931984041_931984047 11 Left 931984041 2:67724388-67724410 CCTCCAGCCAGGTTCTCATAGTC No data
Right 931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG No data
931984043_931984047 4 Left 931984043 2:67724395-67724417 CCAGGTTCTCATAGTCTGAGTGG No data
Right 931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG No data
931984040_931984047 12 Left 931984040 2:67724387-67724409 CCCTCCAGCCAGGTTCTCATAGT No data
Right 931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG No data
931984042_931984047 8 Left 931984042 2:67724391-67724413 CCAGCCAGGTTCTCATAGTCTGA No data
Right 931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931984047 Original CRISPR CCACCTGCCCAAAGCGCAGA AGG Intergenic
No off target data available for this crispr