ID: 931984155

View in Genome Browser
Species Human (GRCh38)
Location 2:67725517-67725539
Sequence TGTGCACTCATGAATTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931984148_931984155 10 Left 931984148 2:67725484-67725506 CCCCATTAACTTTTCATAAGGAA No data
Right 931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG No data
931984149_931984155 9 Left 931984149 2:67725485-67725507 CCCATTAACTTTTCATAAGGAAA No data
Right 931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG No data
931984146_931984155 20 Left 931984146 2:67725474-67725496 CCATCTGATGCCCCATTAACTTT No data
Right 931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG No data
931984150_931984155 8 Left 931984150 2:67725486-67725508 CCATTAACTTTTCATAAGGAAAG No data
Right 931984155 2:67725517-67725539 TGTGCACTCATGAATTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931984155 Original CRISPR TGTGCACTCATGAATTTGGG AGG Intergenic
No off target data available for this crispr