ID: 931987263

View in Genome Browser
Species Human (GRCh38)
Location 2:67754080-67754102
Sequence CTGTAACCTCACATAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931987263_931987267 3 Left 931987263 2:67754080-67754102 CCTTCCACTATGTGAGGTTACAG No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data
931987263_931987266 -3 Left 931987263 2:67754080-67754102 CCTTCCACTATGTGAGGTTACAG No data
Right 931987266 2:67754100-67754122 CAGCAAAAAGTTGGCCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931987263 Original CRISPR CTGTAACCTCACATAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr