ID: 931987267

View in Genome Browser
Species Human (GRCh38)
Location 2:67754106-67754128
Sequence AAAGTTGGCCATCTAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931987261_931987267 5 Left 931987261 2:67754078-67754100 CCCCTTCCACTATGTGAGGTTAC No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data
931987259_931987267 12 Left 931987259 2:67754071-67754093 CCAGTCACCCCTTCCACTATGTG No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data
931987262_931987267 4 Left 931987262 2:67754079-67754101 CCCTTCCACTATGTGAGGTTACA No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data
931987263_931987267 3 Left 931987263 2:67754080-67754102 CCTTCCACTATGTGAGGTTACAG No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data
931987264_931987267 -1 Left 931987264 2:67754084-67754106 CCACTATGTGAGGTTACAGCAAA No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data
931987258_931987267 13 Left 931987258 2:67754070-67754092 CCCAGTCACCCCTTCCACTATGT No data
Right 931987267 2:67754106-67754128 AAAGTTGGCCATCTAGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931987267 Original CRISPR AAAGTTGGCCATCTAGGAAG TGG Intergenic
No off target data available for this crispr