ID: 931988308

View in Genome Browser
Species Human (GRCh38)
Location 2:67762688-67762710
Sequence ATAAGATTGAAAAATATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931988308_931988312 15 Left 931988308 2:67762688-67762710 CCATCTATATTTTTCAATCTTAT No data
Right 931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG No data
931988308_931988313 16 Left 931988308 2:67762688-67762710 CCATCTATATTTTTCAATCTTAT No data
Right 931988313 2:67762727-67762749 CAGTTCACCAGTCCACTATTGGG No data
931988308_931988316 28 Left 931988308 2:67762688-67762710 CCATCTATATTTTTCAATCTTAT No data
Right 931988316 2:67762739-67762761 CCACTATTGGGTAAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931988308 Original CRISPR ATAAGATTGAAAAATATAGA TGG (reversed) Intergenic
No off target data available for this crispr