ID: 931988309

View in Genome Browser
Species Human (GRCh38)
Location 2:67762711-67762733
Sequence TGAACTGGAAATTACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931988309_931988317 10 Left 931988309 2:67762711-67762733 CCTTCCATGTAATTTCCAGTTCA No data
Right 931988317 2:67762744-67762766 ATTGGGTAAAGCAGCTGGCCAGG No data
931988309_931988313 -7 Left 931988309 2:67762711-67762733 CCTTCCATGTAATTTCCAGTTCA No data
Right 931988313 2:67762727-67762749 CAGTTCACCAGTCCACTATTGGG No data
931988309_931988312 -8 Left 931988309 2:67762711-67762733 CCTTCCATGTAATTTCCAGTTCA No data
Right 931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG No data
931988309_931988316 5 Left 931988309 2:67762711-67762733 CCTTCCATGTAATTTCCAGTTCA No data
Right 931988316 2:67762739-67762761 CCACTATTGGGTAAAGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931988309 Original CRISPR TGAACTGGAAATTACATGGA AGG (reversed) Intergenic
No off target data available for this crispr