ID: 931988312

View in Genome Browser
Species Human (GRCh38)
Location 2:67762726-67762748
Sequence CCAGTTCACCAGTCCACTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931988309_931988312 -8 Left 931988309 2:67762711-67762733 CCTTCCATGTAATTTCCAGTTCA No data
Right 931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG No data
931988308_931988312 15 Left 931988308 2:67762688-67762710 CCATCTATATTTTTCAATCTTAT No data
Right 931988312 2:67762726-67762748 CCAGTTCACCAGTCCACTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931988312 Original CRISPR CCAGTTCACCAGTCCACTAT TGG Intergenic
No off target data available for this crispr