ID: 931989297

View in Genome Browser
Species Human (GRCh38)
Location 2:67773675-67773697
Sequence CTTAATGATGCCATAATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931989293_931989297 24 Left 931989293 2:67773628-67773650 CCCTCTTATTTTACAAAAAAAAA No data
Right 931989297 2:67773675-67773697 CTTAATGATGCCATAATCTAGGG No data
931989294_931989297 23 Left 931989294 2:67773629-67773651 CCTCTTATTTTACAAAAAAAAAA No data
Right 931989297 2:67773675-67773697 CTTAATGATGCCATAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931989297 Original CRISPR CTTAATGATGCCATAATCTA GGG Intergenic
No off target data available for this crispr