ID: 931999511

View in Genome Browser
Species Human (GRCh38)
Location 2:67871755-67871777
Sequence AATCGCAGAGATGTACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931999511_931999512 3 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999512 2:67871781-67871803 CTCAGTTCCAACAGATTTTGTGG No data
931999511_931999513 4 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999513 2:67871782-67871804 TCAGTTCCAACAGATTTTGTGGG No data
931999511_931999514 5 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG No data
931999511_931999515 6 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999515 2:67871784-67871806 AGTTCCAACAGATTTTGTGGGGG No data
931999511_931999517 19 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999517 2:67871797-67871819 TTTGTGGGGGCTGAAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931999511 Original CRISPR AATCGCAGAGATGTACAATC TGG (reversed) Intergenic
No off target data available for this crispr