ID: 931999512

View in Genome Browser
Species Human (GRCh38)
Location 2:67871781-67871803
Sequence CTCAGTTCCAACAGATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931999511_931999512 3 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999512 2:67871781-67871803 CTCAGTTCCAACAGATTTTGTGG No data
931999510_931999512 4 Left 931999510 2:67871754-67871776 CCCAGATTGTACATCTCTGCGAT No data
Right 931999512 2:67871781-67871803 CTCAGTTCCAACAGATTTTGTGG No data
931999508_931999512 12 Left 931999508 2:67871746-67871768 CCCTCATTCCCAGATTGTACATC No data
Right 931999512 2:67871781-67871803 CTCAGTTCCAACAGATTTTGTGG No data
931999509_931999512 11 Left 931999509 2:67871747-67871769 CCTCATTCCCAGATTGTACATCT No data
Right 931999512 2:67871781-67871803 CTCAGTTCCAACAGATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931999512 Original CRISPR CTCAGTTCCAACAGATTTTG TGG Intergenic
No off target data available for this crispr