ID: 931999514

View in Genome Browser
Species Human (GRCh38)
Location 2:67871783-67871805
Sequence CAGTTCCAACAGATTTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931999509_931999514 13 Left 931999509 2:67871747-67871769 CCTCATTCCCAGATTGTACATCT No data
Right 931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG No data
931999511_931999514 5 Left 931999511 2:67871755-67871777 CCAGATTGTACATCTCTGCGATT No data
Right 931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG No data
931999510_931999514 6 Left 931999510 2:67871754-67871776 CCCAGATTGTACATCTCTGCGAT No data
Right 931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG No data
931999508_931999514 14 Left 931999508 2:67871746-67871768 CCCTCATTCCCAGATTGTACATC No data
Right 931999514 2:67871783-67871805 CAGTTCCAACAGATTTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931999514 Original CRISPR CAGTTCCAACAGATTTTGTG GGG Intergenic
No off target data available for this crispr