ID: 931999913

View in Genome Browser
Species Human (GRCh38)
Location 2:67875751-67875773
Sequence TAGCTCTGTGTAACTGGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931999913_931999917 19 Left 931999913 2:67875751-67875773 CCATTGCCAGTTACACAGAGCTA No data
Right 931999917 2:67875793-67875815 TTGCAGCTATAAAGAACTGCAGG No data
931999913_931999915 -10 Left 931999913 2:67875751-67875773 CCATTGCCAGTTACACAGAGCTA No data
Right 931999915 2:67875764-67875786 CACAGAGCTAAGCATTTTCCTGG No data
931999913_931999919 29 Left 931999913 2:67875751-67875773 CCATTGCCAGTTACACAGAGCTA No data
Right 931999919 2:67875803-67875825 AAAGAACTGCAGGATAGGCCAGG No data
931999913_931999918 24 Left 931999913 2:67875751-67875773 CCATTGCCAGTTACACAGAGCTA No data
Right 931999918 2:67875798-67875820 GCTATAAAGAACTGCAGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931999913 Original CRISPR TAGCTCTGTGTAACTGGCAA TGG (reversed) Intergenic
No off target data available for this crispr