ID: 932000124

View in Genome Browser
Species Human (GRCh38)
Location 2:67877452-67877474
Sequence TGATTCTCCAGACAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932000124_932000136 23 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000136 2:67877498-67877520 AGAGGGAAACAATTAGGGAGAGG No data
932000124_932000134 18 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000134 2:67877493-67877515 CCCGGAGAGGGAAACAATTAGGG No data
932000124_932000128 0 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000128 2:67877475-67877497 GGCAGACAACCAACTGCTCCCGG No data
932000124_932000132 17 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000132 2:67877492-67877514 TCCCGGAGAGGGAAACAATTAGG No data
932000124_932000130 6 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000130 2:67877481-67877503 CAACCAACTGCTCCCGGAGAGGG No data
932000124_932000137 24 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000137 2:67877499-67877521 GAGGGAAACAATTAGGGAGAGGG No data
932000124_932000129 5 Left 932000124 2:67877452-67877474 CCCTCTGCCTGTCTGGAGAATCA No data
Right 932000129 2:67877480-67877502 ACAACCAACTGCTCCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932000124 Original CRISPR TGATTCTCCAGACAGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr