ID: 932005450

View in Genome Browser
Species Human (GRCh38)
Location 2:67922604-67922626
Sequence CTGTTGGCCTTGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932005441_932005450 7 Left 932005441 2:67922574-67922596 CCTTGTCACCAGTGAACCCTACC No data
Right 932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG No data
932005440_932005450 12 Left 932005440 2:67922569-67922591 CCTTTCCTTGTCACCAGTGAACC No data
Right 932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG No data
932005444_932005450 -9 Left 932005444 2:67922590-67922612 CCCTACCTCTCTCTCTGTTGGCC No data
Right 932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG No data
932005439_932005450 20 Left 932005439 2:67922561-67922583 CCTTCTCTCCTTTCCTTGTCACC No data
Right 932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG No data
932005445_932005450 -10 Left 932005445 2:67922591-67922613 CCTACCTCTCTCTCTGTTGGCCT No data
Right 932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG No data
932005442_932005450 -1 Left 932005442 2:67922582-67922604 CCAGTGAACCCTACCTCTCTCTC No data
Right 932005450 2:67922604-67922626 CTGTTGGCCTTGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932005450 Original CRISPR CTGTTGGCCTTGAGGGGAGA AGG Intergenic
No off target data available for this crispr