ID: 932017273

View in Genome Browser
Species Human (GRCh38)
Location 2:68043939-68043961
Sequence CACACACACCAACCTGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932017273 Original CRISPR CACACACACCAACCTGCCTT GGG Intronic
900516145 1:3083111-3083133 CACACACACAAGCCTGTCTTTGG - Intronic
900970142 1:5987512-5987534 CACTCAACCCAACCAGCCTTGGG - Intronic
902799522 1:18820619-18820641 CACACAAACCGCCCTGCTTTCGG + Intergenic
903300761 1:22377042-22377064 TACACACACCAAGTTTCCTTGGG + Intergenic
903339238 1:22643792-22643814 CTCACACACCAAGCTGCCCCTGG - Intronic
904618123 1:31760837-31760859 CACACCCTCCATCCTGCCTCCGG + Intronic
906104774 1:43285285-43285307 CACACACACTAACCTTCCAAGGG + Intronic
907404204 1:54243783-54243805 CAGACACGCCAACCTGCCCCAGG + Intronic
910099338 1:83559929-83559951 CACACACTCCATCCAGCCTTGGG + Intergenic
910551672 1:88482396-88482418 AACACACCCCATCCTGCCCTAGG + Intergenic
911199109 1:95026454-95026476 CACACACACACACATTCCTTGGG - Intronic
912630637 1:111243816-111243838 CACACACATACACCTGCCTCTGG + Intergenic
912955399 1:114152070-114152092 CACACACACAAGCCTCCCCTTGG + Intronic
913225801 1:116697059-116697081 CACACACACCAAGAGGCCTCAGG + Intronic
915120152 1:153625325-153625347 CACACACTTCAACGTGCCTGTGG + Intronic
915167085 1:153953994-153954016 CACACACCCCAGCCTGGCTATGG + Intronic
915489091 1:156241653-156241675 CACCCACAGCAGGCTGCCTTTGG + Intronic
917494769 1:175530333-175530355 CACACACACCCGCCTCTCTTTGG + Intronic
918453640 1:184685174-184685196 CACCCAGCCCAAACTGCCTTAGG + Intergenic
919314378 1:195952865-195952887 CACACACACTTATCTGTCTTTGG + Intergenic
919621112 1:199865575-199865597 GACAAACACCAACCTGGCGTGGG - Intergenic
919761624 1:201101752-201101774 CACACCCACCATCCTCCCATGGG - Intronic
919990595 1:202706357-202706379 CACACACACAACACTGTCTTGGG - Intronic
920088017 1:203432290-203432312 CAGGCACAACAACGTGCCTTTGG - Intergenic
920176105 1:204102943-204102965 CACACCCACCCACCTGCCTCCGG + Intronic
920815391 1:209326692-209326714 AACACACACCAGCCTGCAATAGG + Intergenic
923910739 1:238440468-238440490 CACACACACACAACTGTCTTTGG - Intergenic
1062972329 10:1658720-1658742 CAGAGCCTCCAACCTGCCTTAGG + Intronic
1064064803 10:12172752-12172774 GACACACACATACCTGGCTTTGG + Exonic
1064274115 10:13891386-13891408 CACACACACCTACTTTCCTTGGG - Intronic
1065804407 10:29381549-29381571 CACAGAAACTAACCTGCCTGAGG - Intergenic
1065944779 10:30596477-30596499 CACAGAAACTAACCTGCCTAAGG + Intergenic
1066028487 10:31391219-31391241 CACACACACAAACTTACCTGTGG - Intronic
1066800280 10:39180806-39180828 CACACAAATAAACCTTCCTTTGG + Intergenic
1067545944 10:47192855-47192877 CACACACACTAAGCTGTCCTGGG + Intergenic
1067852205 10:49761335-49761357 CACACACACAACCCTGTCTGGGG + Intronic
1069226421 10:65950877-65950899 CACACACACAAACCTGGATATGG - Intronic
1069583268 10:69579314-69579336 CACACACACAAAATTTCCTTGGG + Intergenic
1069984992 10:72276919-72276941 CACCCACACCAACTGGCATTTGG + Intergenic
1070373415 10:75806831-75806853 CACACAAAAAAACCTACCTTGGG + Intronic
1071566364 10:86673350-86673372 CACACACAGCCGTCTGCCTTTGG - Intronic
1071586406 10:86826429-86826451 CACACACACACACCCGCTTTTGG + Intronic
1072814853 10:98496529-98496551 CATACACAGCTACCTGCCATAGG + Intronic
1074273549 10:111979070-111979092 CACACACACAAACCTGGAATCGG + Intergenic
1074713995 10:116201658-116201680 CCCACAGACCAACCAGGCTTGGG + Intronic
1078354303 11:10622892-10622914 CACACACACACTCCTGCCCTTGG + Intronic
1078878119 11:15418752-15418774 CACACACACCACTATGCCTGAGG - Intergenic
1078930376 11:15907881-15907903 CACACACACCAGCCAGCCCTAGG + Intergenic
1079102655 11:17551523-17551545 CCCCCACCCCAACCTTCCTTTGG - Intronic
1080570396 11:33551089-33551111 CAAATACACCAACTTCCCTTTGG - Exonic
1080925537 11:36752364-36752386 CACACACACTAACCAGTCATAGG + Intergenic
1082926746 11:58555777-58555799 CACACACACACACACGCCTTTGG + Intronic
1083250137 11:61461078-61461100 CATACTCACAAACCTCCCTTCGG + Intronic
1084795399 11:71501750-71501772 CACACACACCTTCCTGTCCTGGG + Exonic
1084877187 11:72141915-72141937 CACAGACACAACCCTGCTTTCGG - Intergenic
1085016409 11:73177004-73177026 CCCCCACACCACCCTGCCTCAGG - Intergenic
1088579765 11:111303258-111303280 GACACACACACACTTGCCTTTGG + Intronic
1089270914 11:117300658-117300680 CAACCACACCAACCTGCCTGCGG + Intronic
1089999945 11:122947913-122947935 CTCCCATACCAACCTGCCATTGG + Intronic
1090629093 11:128630654-128630676 GCCACACGCTAACCTGCCTTTGG - Intergenic
1091397755 12:164010-164032 CACACACACCAGCCTCGCCTAGG - Intronic
1091451506 12:575207-575229 CACACAAGCCCACCTGCATTGGG + Intronic
1091703211 12:2677586-2677608 CACACACACAAACCTTCCGGAGG + Intronic
1092214586 12:6672262-6672284 CACACACAACAACCCGCATGCGG - Intronic
1092837959 12:12509836-12509858 CACCCACACCAACTAGCTTTTGG - Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1096658501 12:53106266-53106288 CACACACACACATCTGCCTCAGG - Intronic
1097695510 12:62771327-62771349 CACACACACACACGGGCCTTTGG + Intronic
1097766493 12:63532816-63532838 CACACACACACCCCTGCCTTTGG + Intergenic
1101032000 12:100669873-100669895 CACACACACAAACCTGGTTGGGG + Intergenic
1101736171 12:107464998-107465020 CCCACACACCAACCATGCTTAGG + Intronic
1102232785 12:111275163-111275185 GACACACATCAACCTGCTCTGGG - Intronic
1102376583 12:112426711-112426733 CACACACACAAACCAGCACTTGG - Intronic
1104998196 12:132672362-132672384 CACCCACACTAGCCTGCCTCAGG + Intronic
1105068210 12:133217837-133217859 CACAAATACCAACCTTCCTGTGG - Intergenic
1106794260 13:33188101-33188123 CAGATTCACCCACCTGCCTTTGG - Intronic
1109484073 13:62996305-62996327 CACCCACACCAAGCTCCCATGGG + Intergenic
1111743118 13:92229841-92229863 CACCTACACCAACTTGCCTTTGG - Intronic
1113653569 13:112054912-112054934 CACTTAGACCAACGTGCCTTTGG + Intergenic
1114690241 14:24574274-24574296 CCCCCACACAAATCTGCCTTCGG + Exonic
1114844400 14:26303585-26303607 CACACACACACACCTGGCTCAGG + Intergenic
1119515091 14:75241696-75241718 CACACACACAGATCTGTCTTTGG - Intronic
1120577003 14:86194873-86194895 CACAAGCACAAACCTGCCTCAGG + Intergenic
1121419493 14:93802647-93802669 CACACCTACCAACATGCCATTGG - Intergenic
1121660568 14:95632284-95632306 CACAGGCACCCACCTGCCCTGGG + Intergenic
1122941370 14:104982921-104982943 CACACGCCCCAACTTGCCCTAGG + Intergenic
1123004935 14:105316587-105316609 CACACGCCCCCACCTCCCTTGGG - Intronic
1123181234 14:106472398-106472420 CCCACACACAAACCTTCCTGTGG - Intergenic
1202945659 14_KI270726v1_random:24302-24324 CCCACACACAAACCTTCCTGTGG + Intergenic
1123401312 15:19989786-19989808 CCCACACACAAACCTCCCTGTGG - Intergenic
1124342976 15:28901854-28901876 CACACACACAAACCAGCATCGGG + Intronic
1125201110 15:37101296-37101318 CACACACACACACACGCCTTTGG - Intronic
1126894757 15:53246256-53246278 CACACACACACACCACCCTTTGG + Intergenic
1127867426 15:63043507-63043529 CCCGCACACCCACCTGCCCTGGG - Intronic
1128168276 15:65486826-65486848 CACACCCACCACCCTTCCTCTGG - Intronic
1128418835 15:67472422-67472444 GACACAGACCAACCTGTGTTAGG + Intronic
1132041211 15:98525705-98525727 CACACACACACCCCTGCCCTGGG + Intergenic
1132282377 15:100631371-100631393 CACACAGATCTGCCTGCCTTGGG + Intronic
1132461926 16:59719-59741 CACGCACACGTACCTGCCCTTGG + Exonic
1137373823 16:47933369-47933391 CACACAGACCTACCTTGCTTGGG + Intergenic
1137392454 16:48092742-48092764 CTCCCACATCAACCTGCTTTTGG - Intronic
1137744734 16:50812390-50812412 CTCAAACACCAATCTTCCTTGGG + Intergenic
1138138017 16:54540628-54540650 CAAACATTCCAACCTGTCTTTGG - Intergenic
1139650128 16:68358045-68358067 CTCACACACTAACCCCCCTTTGG + Exonic
1141799980 16:86300933-86300955 AACACAGACCTACCTTCCTTTGG - Intergenic
1143692780 17:8584406-8584428 GACACACTTCAACTTGCCTTGGG + Intronic
1144791568 17:17862507-17862529 CACACACACTCTCCTGCCCTTGG - Intronic
1146376660 17:32299105-32299127 CATACACACAAAGCTCCCTTGGG - Intronic
1146682676 17:34819496-34819518 TGCAAACACCATCCTGCCTTTGG + Intergenic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147364142 17:39949489-39949511 CACACACACGTATCTGCCTCGGG + Intergenic
1148751088 17:49946315-49946337 CTCACACACCTCCCTGCCTCAGG + Intergenic
1152699386 17:81811579-81811601 CCCACCCACCCACCTGCCTGGGG - Intronic
1155023914 18:21923572-21923594 CACACACACCTACTTGGCTGAGG - Intergenic
1155145596 18:23080883-23080905 CCCCCACCTCAACCTGCCTTTGG + Intergenic
1156464968 18:37342919-37342941 CACAGACACCCACATGCCATGGG - Intronic
1157551877 18:48587928-48587950 CACAGACCCCAAGATGCCTTTGG - Intronic
1159185277 18:64963570-64963592 CACACACACACACCTCCCTAAGG + Intergenic
1160282299 18:77502769-77502791 CACACCCACCCACCTGCATGGGG + Intergenic
1160805993 19:992369-992391 CCCACACACCAGCCTTCCTGCGG + Intronic
1161161429 19:2763646-2763668 CACTCACCCCATCCTGCCGTAGG + Exonic
1161987101 19:7661956-7661978 CACACACTCCATTCTGCCTCAGG + Intergenic
1162027967 19:7904861-7904883 CACCCACACCCACCTGACCTGGG + Intronic
1163591192 19:18194952-18194974 CACACGCACCAGTCTGCCTGCGG - Exonic
1163648516 19:18503751-18503773 CAGAAACACCACCCTTCCTTGGG + Intronic
1163933801 19:20423787-20423809 CACAAAAACAAAACTGCCTTAGG - Intergenic
1167822618 19:51942529-51942551 CTCAAACACACACCTGCCTTGGG - Intronic
928138630 2:28708364-28708386 AACAGACAACAAACTGCCTTTGG + Intergenic
929049124 2:37819691-37819713 CACACACATCACACTTCCTTGGG - Intergenic
929447074 2:42010125-42010147 CCCACACACCAGGCTGCCTTTGG + Intergenic
930058469 2:47269919-47269941 CACACACTCCAGCCAGCCCTGGG + Intergenic
932017273 2:68043939-68043961 CACACACACCAACCTGCCTTGGG + Intronic
932723340 2:74156401-74156423 CTATCACACCAACCTACCTTTGG + Exonic
933693408 2:85196954-85196976 CAGCCACACCAACCTGCCGCAGG + Intronic
933727165 2:85433549-85433571 CACACACCCCTCCCTACCTTAGG + Intronic
935632331 2:105222488-105222510 TACAGCCACCAACCTGTCTTGGG - Intergenic
935915364 2:107943890-107943912 CAAACACACCCACCTACCTGGGG - Intergenic
936735189 2:115432647-115432669 CACACACACAAAATTGCCTATGG - Intronic
936890231 2:117360503-117360525 CACCCACACCAAGCTCCCATGGG - Intergenic
937658512 2:124404150-124404172 CAAACACACCACCTTGCCTAAGG - Intronic
938721881 2:134074787-134074809 CACACCCACTAACATTCCTTTGG + Intergenic
946076031 2:217074411-217074433 CACACACACACACCTGCCCCTGG + Intergenic
946756276 2:222951023-222951045 TACAAACACAAATCTGCCTTCGG - Intergenic
948674810 2:239591081-239591103 CACACACACAACCCTCCCATGGG + Intergenic
1172434522 20:34919567-34919589 CACACACACACACTTGCCTTGGG - Exonic
1174083812 20:47990381-47990403 CACAAGCACCATCCTGCCTCAGG - Intergenic
1174358367 20:50013019-50013041 CACACACACCATCCATCCTGGGG - Intergenic
1174376518 20:50129850-50129872 CACAGACCCCATCCAGCCTTTGG + Intronic
1175042435 20:56067165-56067187 TACACACACCAACATGCATGAGG + Intergenic
1175426008 20:58867456-58867478 CACAAACACCAAACTGCCCTAGG - Intronic
1176551160 21:8222562-8222584 CACACACACACACCTACCTACGG - Intergenic
1176570069 21:8405561-8405583 CACACACACATACCTACCTACGG - Intergenic
1176577980 21:8449768-8449790 CACACACACATACCTACCTACGG - Intergenic
1178635028 21:34294950-34294972 CACACACACCCACTTGCCGGGGG - Intergenic
1180611857 22:17103568-17103590 CACACTCACCCACCTGCACTTGG - Exonic
1183932694 22:41245393-41245415 CTCACCCAGCACCCTGCCTTTGG - Intergenic
1203256185 22_KI270733v1_random:139519-139541 CACACACACATACCTACCTACGG - Intergenic
952087924 3:29849162-29849184 CACACACACACACATTCCTTTGG - Intronic
952188982 3:31001959-31001981 GATACTCCCCAACCTGCCTTTGG - Intergenic
954330807 3:49889290-49889312 CTCACAGTCCTACCTGCCTTGGG - Intronic
954335219 3:49912338-49912360 AACACACCCCCACCTGCCTCAGG + Intronic
955747526 3:62154792-62154814 GCAGCACACCAACCTGCCTTAGG - Intronic
956489737 3:69757989-69758011 CACACACACACACATGCCCTAGG - Intronic
956850706 3:73225654-73225676 GACAAACCCCAAACTGCCTTTGG - Intergenic
957827928 3:85474134-85474156 CACACACACAAACCTCCTGTTGG - Intronic
957945962 3:87063386-87063408 CACACACGCAATCCTGCATTTGG - Intergenic
961214801 3:125150973-125150995 CACACACACCAAGTTTCCTCAGG + Intronic
962985732 3:140534193-140534215 GACACACTCCAACCAGCCTGTGG + Intronic
964594088 3:158402095-158402117 AACCCAAACAAACCTGCCTTGGG - Intronic
964635863 3:158858372-158858394 CACCCACACCAAACTCCCATGGG + Intergenic
964822794 3:160792006-160792028 AACACACACCCATCTACCTTAGG - Intronic
967582125 3:191171650-191171672 CACACACACGACCATGACTTTGG - Intergenic
969249068 4:5955335-5955357 CACACACCCCCGCCTGGCTTTGG - Intronic
969418778 4:7077687-7077709 CACAAACACCACACTGCCTGTGG + Intergenic
971832033 4:31706858-31706880 CACACACACACACATTCCTTTGG + Intergenic
972825430 4:42753343-42753365 CACACACACCAACATCTCCTTGG + Intergenic
973126419 4:46591041-46591063 CACACACACACACCTGCCTGTGG - Intergenic
973184720 4:47312029-47312051 CACACACACACACAAGCCTTGGG - Intronic
973894592 4:55398629-55398651 CACACACATCTTGCTGCCTTGGG + Intronic
975869649 4:78765903-78765925 CAAACACACAAATCTGCTTTAGG - Intergenic
976915252 4:90365304-90365326 CACACACATCAACATGAATTGGG - Intronic
980085792 4:128388395-128388417 CACTGACACCACGCTGCCTTGGG + Intergenic
980178042 4:129370943-129370965 GACCCACACTAACCAGCCTTAGG + Intergenic
981588078 4:146326206-146326228 CACAACCACCAATCTGCCTTAGG + Intronic
981841307 4:149115764-149115786 CACACACATCACCTTGCGTTTGG + Intergenic
982406625 4:155027505-155027527 CACACATACCACCCTCTCTTTGG + Intergenic
983510188 4:168601492-168601514 CACATTGACAAACCTGCCTTAGG + Intronic
984658497 4:182346664-182346686 CACAAACTCCTAACTGCCTTAGG - Exonic
985257762 4:188086543-188086565 CACACACACCAGAGTGCATTTGG + Intergenic
987275151 5:16354713-16354735 CACACACACAAGCCTGATTTGGG + Intergenic
988482528 5:31641823-31641845 CACACTCACCATGCTGCCCTGGG + Intronic
989640239 5:43577110-43577132 CACACACCCCCACCAGCCTCAGG - Intergenic
990322961 5:54647948-54647970 CGCACACACCAGCATTCCTTCGG - Intergenic
990517503 5:56544066-56544088 CACACACACCAGCCTCACTTGGG + Intronic
990909564 5:60840161-60840183 CACACAATTCAACCTGCCATAGG - Intronic
992171304 5:74104588-74104610 CACACACACACACCTTCCTTTGG + Intergenic
992233718 5:74686694-74686716 CACACACACTAATGAGCCTTTGG + Intronic
993458661 5:88156377-88156399 CACACACACATCCCTACCTTCGG - Intergenic
994560753 5:101367846-101367868 CACAGACACCATACTGCCTCTGG + Intergenic
996108181 5:119531559-119531581 CACACACACACACCCCCCTTTGG - Intronic
997639728 5:135441288-135441310 TACACACACACACCTGCCTCTGG - Intergenic
999897756 5:156053186-156053208 CACACACACCAATCACCCTGTGG - Intronic
1000691055 5:164321180-164321202 CACACACACACACATGGCTTTGG + Intergenic
1003118902 6:3304182-3304204 CACACACACCCTCCTGCCTCAGG - Intronic
1003503870 6:6724543-6724565 CACACAAAGCTACCTGTCTTCGG + Intergenic
1004260497 6:14103314-14103336 TACCCACACAAGCCTGCCTTTGG + Intergenic
1005423759 6:25679474-25679496 CACACACACACACCTGCCCACGG - Intronic
1006448343 6:34092167-34092189 CCTACACACCAACCTCCCTTTGG + Intronic
1006450323 6:34102203-34102225 TTCACACACCAGCCTTCCTTTGG + Intronic
1007065241 6:38984489-38984511 CACACACAACAACCAGCAATTGG + Intronic
1007829252 6:44625782-44625804 CAGACACACCAACCTGCACGAGG + Intergenic
1009631159 6:66202683-66202705 CACAAACTGCAACCTGCTTTGGG + Intergenic
1010031892 6:71279899-71279921 CACTCACACTAACCTGCTCTGGG - Intergenic
1011057147 6:83217752-83217774 CTCACACACAACTCTGCCTTTGG - Intronic
1011740918 6:90359822-90359844 CACACACACCACCCTCCCCCAGG - Intergenic
1012613008 6:101238969-101238991 CACACACACACTGCTGCCTTTGG - Intergenic
1013122658 6:107154960-107154982 CACAGACACCAAGCAGCCTTAGG - Intronic
1017829557 6:158113838-158113860 CCCACACACCAGACTGCCCTGGG - Intronic
1018709450 6:166487233-166487255 GACACACACCCACGTGCCCTGGG + Intronic
1020081434 7:5288020-5288042 CACACAGCCCAGCCTGCTTTGGG - Intronic
1020960608 7:14798001-14798023 CACAGACAGCAACCTGATTTCGG - Intronic
1021790898 7:24204508-24204530 CACACAAACCATCCCGCCTGGGG - Intergenic
1023803081 7:43851740-43851762 CACAGACAGCAACCTGATTTTGG + Intergenic
1024871374 7:53965668-53965690 CACACACACACACATGCCTGTGG - Intergenic
1025197476 7:56944128-56944150 CACACAGCCCACCCTGCTTTGGG + Intergenic
1025583400 7:62749095-62749117 CACAGAGATAAACCTGCCTTTGG + Intergenic
1025674471 7:63632811-63632833 CACACAGCCCACCCTGCTTTGGG - Intergenic
1027349344 7:77294450-77294472 CACACACACCTACCTCTCATTGG - Intronic
1029589571 7:101498383-101498405 GACACCCAACATCCTGCCTTTGG + Intronic
1029906255 7:104096142-104096164 CACACACACCACCCCGACTCTGG + Intergenic
1030832621 7:114244498-114244520 CACACACACAAACATCCCATAGG - Intronic
1031979070 7:128112702-128112724 GACACACAGCAACCTGCCTGGGG + Intergenic
1032204696 7:129852028-129852050 CACAAACGTCATCCTGCCTTTGG - Intronic
1033016644 7:137678285-137678307 AACACACAACAACCTACCCTGGG + Intronic
1033655973 7:143374702-143374724 CAGCCACACCTACCTGCCTTGGG + Intergenic
1033969249 7:147018794-147018816 CATACACACTATCCTGTCTTTGG - Intronic
1035458953 7:159027551-159027573 GAGCCACACCAACCAGCCTTTGG - Intergenic
1036114514 8:5944185-5944207 CACACACACACACTTGCATTAGG + Intergenic
1036546664 8:9777451-9777473 CACAAACACCAACCTGACTTAGG + Exonic
1036597713 8:10229158-10229180 GACACACACTCACCTGCCCTTGG + Intronic
1037627652 8:20622145-20622167 CACACACACATACCTGCCCTAGG + Intergenic
1037750040 8:21675627-21675649 CACACACACCCCCCTCCGTTTGG - Intergenic
1040285655 8:46099205-46099227 CACCCTCACCAGCCTGCCTGTGG - Intergenic
1041789262 8:61673825-61673847 CACACACACACACAAGCCTTAGG + Intronic
1042662807 8:71174317-71174339 TCCACACCCCGACCTGCCTTAGG + Intergenic
1043219384 8:77640046-77640068 CACATATACCAACCTGCCGGGGG - Intergenic
1046417188 8:113932999-113933021 CACACACACACACCTTCTTTAGG + Intergenic
1046461303 8:114540793-114540815 CACACACACATGCCAGCCTTAGG - Intergenic
1048292328 8:133190691-133190713 CCCACACACCCGCCTGCCTGGGG + Intergenic
1048370639 8:133773498-133773520 CACCCACATCAGCCTGCATTAGG - Intergenic
1051157514 9:14167055-14167077 CACACACAACAATATGCCCTTGG - Intronic
1051193590 9:14539042-14539064 CACACACCCCACACTGCCTATGG - Intergenic
1053106839 9:35416644-35416666 CACTCACACCAAGCTCCCATGGG - Intergenic
1053284640 9:36842295-36842317 CACACACACCCGCCTTCCTCTGG - Intronic
1055219382 9:73909868-73909890 CACACACACACACTTGCCATTGG + Intergenic
1057392701 9:94652830-94652852 CACACACACACACATGACTTTGG + Intergenic
1057877881 9:98771606-98771628 CAGGCACACCAACCTCCTTTGGG + Intronic
1058504902 9:105657017-105657039 TACACACACCAAACTGGCTGCGG + Intergenic
1058771530 9:108237751-108237773 CGCTCACACCATCCTGCCCTTGG - Intergenic
1060881057 9:127118366-127118388 CACAAACTCCAAGCTGCCTGTGG + Intronic
1203472341 Un_GL000220v1:121226-121248 CACACACACATACCTACCTACGG - Intergenic
1186351281 X:8742246-8742268 CACACGCACAATCCTGCCTCAGG + Intergenic
1188094346 X:26003320-26003342 CACCCACACCAAGCTCCCATAGG - Intergenic
1188480129 X:30629077-30629099 CACACACACAAAACTGACTCTGG - Intergenic
1189566216 X:42244034-42244056 CACACACACCAAGCTCCATGAGG - Intergenic
1193629511 X:83865277-83865299 CACACGCACCAACATAGCTTTGG + Intronic
1194337599 X:92666582-92666604 CACACACACTGACCTCCCATGGG - Intergenic
1194640211 X:96394949-96394971 GATACACATCAACCTGGCTTTGG + Intergenic
1195356041 X:104040522-104040544 CACCCACACCAACCTCCGGTGGG - Intronic
1195555070 X:106212262-106212284 CAGACACACAAACCTACATTAGG - Intergenic
1196117839 X:112016345-112016367 CACACACTCCAACCTTCCAGAGG - Intronic
1198804691 X:140481993-140482015 CACTCTCACTACCCTGCCTTTGG - Intergenic
1199555401 X:149102460-149102482 CACATACACCAACGTGCCAGAGG + Intergenic
1199722463 X:150551769-150551791 CACACACACGCACATGTCTTTGG + Intergenic