ID: 932017423

View in Genome Browser
Species Human (GRCh38)
Location 2:68045631-68045653
Sequence GTTGATTTACTAGCAAAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932017423 Original CRISPR GTTGATTTACTAGCAAAGAC GGG (reversed) Intronic
900835881 1:5003566-5003588 GTGGATTTAAGAGCAGAGACTGG - Intergenic
901528700 1:9840430-9840452 ATTGATTTATCAGCCAAGACAGG + Intergenic
905214800 1:36399425-36399447 TTTGATTTACTTGTAGAGACAGG + Intergenic
906114446 1:43347029-43347051 ATAGATATACTAGCAGAGACTGG - Intronic
911752174 1:101507969-101507991 CTGGAATTACTATCAAAGACTGG + Intergenic
911866117 1:103024301-103024323 ATTGATTTATTTGTAAAGACAGG + Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
916161032 1:161914995-161915017 GTGAATTTACTAGTAATGACTGG - Intronic
920389024 1:205587326-205587348 GTTGAATTTCTAGCAGAGAGCGG + Intronic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
922315618 1:224439259-224439281 GTGGATTTAAGCGCAAAGACAGG + Intronic
924312006 1:242753753-242753775 ATTGATTTACCAGCTAAAACAGG - Intergenic
1065632982 10:27700188-27700210 GATGATTTACTAACAAAGTATGG + Intronic
1066449323 10:35513774-35513796 TGTCATTTACTAGCAAAGATGGG + Intronic
1066660256 10:37731560-37731582 GTAGAATGACTAGCAAAGAGGGG + Intergenic
1072829921 10:98646926-98646948 GTTTATTTACTATGAAAAACTGG - Intronic
1074581702 10:114725226-114725248 GTGGATATACCAGCAAAAACAGG + Intergenic
1075352575 10:121737108-121737130 GTTATTTTACTAACAAAGCCAGG - Intergenic
1079748651 11:24166149-24166171 ATTGGTTTATTAGCAAAGTCAGG - Intergenic
1081076483 11:38680394-38680416 TTTGATATTCTAGCAAAAACTGG + Intergenic
1085237339 11:75025290-75025312 GTTGATTTTCCAGAAAAGATGGG + Intergenic
1086482372 11:87255931-87255953 GATGATATACTAGCAAATTCTGG - Intronic
1087220876 11:95545146-95545168 TTTGATTTACTAGCTAGGCCAGG + Intergenic
1089825249 11:121269398-121269420 GTTGATTAAATAGCAATGAACGG + Intergenic
1091784879 12:3237312-3237334 GATGACTTACGATCAAAGACAGG + Intronic
1092021369 12:5205237-5205259 GTTGCTCTGCTAGCCAAGACTGG + Intergenic
1092807003 12:12233531-12233553 GTTGACTTAATTGAAAAGACTGG - Intronic
1092935017 12:13353062-13353084 GTAGTTCTACTAGCAAGGACCGG - Intergenic
1095802440 12:46282300-46282322 GTTTATGTACCAGCAATGACAGG - Intergenic
1096602058 12:52736354-52736376 CTTGATTTTCTAGCCAAAACAGG + Intergenic
1097830589 12:64220937-64220959 GCTAATTTATTAGCAAAAACTGG - Intronic
1103177229 12:118875088-118875110 GCTGCTTAACTAGCAGAGACTGG + Intergenic
1106754956 13:32813454-32813476 GTGGATTTATTAGTAAAGCCAGG - Intergenic
1108468698 13:50745817-50745839 GTCTATTTAATAGGAAAGACAGG + Intronic
1114345563 14:21790843-21790865 GTTGATTTGCTTCCAAAGACTGG - Intergenic
1116736176 14:48694963-48694985 GGTGACTTAACAGCAAAGACCGG - Intergenic
1116763567 14:49043989-49044011 TTTGATATAATGGCAAAGACAGG + Intergenic
1116928848 14:50669760-50669782 GTTTATGTACTGGAAAAGACGGG + Intergenic
1120162814 14:81163587-81163609 GTTGATTTACTAATAAAATCAGG - Intergenic
1127236628 15:57059833-57059855 TTTGATCCACTAGCAAAAACTGG - Intronic
1134184915 16:12077099-12077121 GTTGTTTTATTTGTAAAGACAGG - Intronic
1135482844 16:22836827-22836849 ATTTATTTACTAGTAGAGACGGG + Intronic
1138006191 16:53340095-53340117 ATGGATTTAGTACCAAAGACTGG - Intergenic
1139170778 16:64627483-64627505 CCTGATTTACTAGCAAAGCAGGG + Intergenic
1139618781 16:68119680-68119702 GTTAATTTAATAGGAAAGTCTGG - Intronic
1146985853 17:37217088-37217110 TTTGATTTTTTAGTAAAGACGGG - Intronic
1152405177 17:80094054-80094076 GTTGATTTAAAAGAAAAAACAGG - Intronic
1153481456 18:5551352-5551374 TCTGTTTTACTAGCACAGACGGG + Intronic
1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG + Intronic
925282637 2:2695444-2695466 GCAGATTTAGTGGCAAAGACGGG + Intergenic
927594220 2:24382675-24382697 GTTGTTTTACTATTAAAGTCAGG + Intergenic
928142871 2:28745761-28745783 ATTGATTTACTAGCAAAACGAGG - Intergenic
930213635 2:48670220-48670242 TTTGTTTTATTAGTAAAGACAGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG + Intergenic
937763813 2:125635870-125635892 GTATATATACTAGCAAACACTGG - Intergenic
941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG + Exonic
943063346 2:183061374-183061396 GTTGTATTATTAGTAAAGACAGG - Intergenic
944655738 2:201875007-201875029 TTTGATTTCCTAGCACAGCCTGG - Intronic
947072527 2:226306461-226306483 TTTGTATTTCTAGCAAAGACAGG - Intergenic
948256997 2:236575848-236575870 ATTTATTTACGAGCAAACACTGG - Intronic
1169108536 20:3018109-3018131 GTTGTTTGACTACCAAATACAGG - Intronic
1170084858 20:12517712-12517734 AGTGATTGACTAGAAAAGACAGG - Intergenic
1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG + Intergenic
1177103641 21:16926313-16926335 TTTGTGCTACTAGCAAAGACAGG + Intergenic
1177187686 21:17816410-17816432 GATGATTTGCCAGCAAACACTGG + Intronic
1179076481 21:38127028-38127050 GCTTATTACCTAGCAAAGACAGG - Intronic
1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG + Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184869812 22:47229791-47229813 GTTGTTTTCCTTGCAATGACAGG + Intergenic
949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG + Intronic
949601104 3:5598631-5598653 GTTGACTAACTTGCAAACACGGG + Intergenic
949707766 3:6838609-6838631 GCAGATTTATTAGAAAAGACAGG - Intronic
951075510 3:18386539-18386561 GAAGGTTTACCAGCAAAGACTGG + Exonic
951352489 3:21623468-21623490 CTTGATTTTCTTGTAAAGACTGG - Intronic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
962285597 3:134083697-134083719 GTTGATTCACTTGAAAAGATTGG + Intronic
964830257 3:160876634-160876656 ATTGATTTACTAGAAAACAATGG + Intronic
966071257 3:175881223-175881245 GTTGTTTTATTAGCAGAAACAGG - Intergenic
969888677 4:10239666-10239688 GCAGACTGACTAGCAAAGACTGG + Intergenic
970340021 4:15096104-15096126 GTTCATGTAGTAGAAAAGACAGG - Intergenic
974076935 4:57175736-57175758 TTGGATTTACCAACAAAGACAGG - Intergenic
974393364 4:61303188-61303210 GTAGTTTTACTTTCAAAGACTGG + Intronic
974670492 4:65024041-65024063 GATGATTTACTAAGTAAGACAGG - Intergenic
978518327 4:109593312-109593334 GTTACTTTACAACCAAAGACTGG - Intronic
983610905 4:169643902-169643924 GTTGTTTTACTTGAAAAGACAGG + Intronic
984827343 4:183938319-183938341 GTTAATTTACTAACACAAACTGG - Intronic
988166299 5:27594557-27594579 GTAGAAATAGTAGCAAAGACTGG - Intergenic
989324239 5:40172206-40172228 CTTGATTTACTAATAGAGACTGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
994468830 5:100176090-100176112 GTAGATTTATTAGCAAAAAGTGG + Intergenic
995303707 5:110617789-110617811 GTTGATTTTTTAGTAGAGACAGG - Intronic
997344747 5:133180531-133180553 GTTGTTGTAATAGCAAAGGCTGG - Intergenic
1002642621 5:180637499-180637521 GATGATTGCATAGCAAAGACTGG - Intronic
1014158658 6:118141012-118141034 GTTAATTTACTATTAAAGAAAGG + Intronic
1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG + Intergenic
1017622401 6:156312828-156312850 GTTGTTTTACTAGAAGTGACAGG + Intergenic
1020455168 7:8364534-8364556 GTCCATTTCCTAGCAAACACAGG - Intergenic
1020618386 7:10488769-10488791 GTTGAATCACTATCAAACACAGG - Intergenic
1023267396 7:38421539-38421561 TTTGATATATTTGCAAAGACAGG - Intronic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1032024682 7:128431530-128431552 ATTGCTTTACTAGCAAAGCCCGG - Intergenic
1036220248 8:6915237-6915259 GATGAGTGACTAGCAAAGCCTGG + Intergenic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1037537324 8:19836811-19836833 GTTTTTTTAATAGCAAAGAATGG + Intronic
1037917374 8:22780906-22780928 GGTGATTCACTAAGAAAGACAGG - Intronic
1039628201 8:39078209-39078231 GTTTATTTAGTTGCAAGGACAGG - Intronic
1041675367 8:60533070-60533092 GTTATTTTACAAGCAAATACTGG - Intronic
1042538274 8:69881242-69881264 GTTGATTTTCTTGAAAAGATAGG - Intergenic
1043656146 8:82669265-82669287 TTTGATTTACAATCAGAGACAGG - Intergenic
1043683446 8:83060299-83060321 GTCGATTTGCTGGGAAAGACTGG - Intergenic
1045536463 8:103033346-103033368 GTTGATTTTATAGAAAAAACGGG + Intronic
1046228923 8:111327194-111327216 CATGACTAACTAGCAAAGACAGG - Intergenic
1047971575 8:130089053-130089075 GTTCATGTACTAGGAAAGACAGG + Intronic
1052358670 9:27530154-27530176 GTGGATTTACTAGAACACACTGG + Intergenic
1057950394 9:99365220-99365242 GCTGATTGACTAGCTTAGACTGG - Intergenic
1197994567 X:132359335-132359357 GTTGAGTTACTAGCAATGTGAGG + Intergenic
1202025153 Y:20513812-20513834 GTTCATTTACTATTAAAGAAAGG + Intergenic