ID: 932018060

View in Genome Browser
Species Human (GRCh38)
Location 2:68053276-68053298
Sequence CTGTATAACCAGTGAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932018060_932018062 -4 Left 932018060 2:68053276-68053298 CCTTCCTCTCACTGGTTATACAG 0: 1
1: 0
2: 1
3: 10
4: 165
Right 932018062 2:68053295-68053317 ACAGAAGCCAAAGTACCGATAGG 0: 1
1: 0
2: 1
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932018060 Original CRISPR CTGTATAACCAGTGAGAGGA AGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900791457 1:4683717-4683739 CTGTGGGACAAGTGAGAGGAAGG - Intronic
902034900 1:13450535-13450557 CTGTATAATCAGTCAGACAAAGG - Intergenic
905226883 1:36484755-36484777 CTGCATGACTAGGGAGAGGAGGG - Intergenic
905938133 1:41840932-41840954 CTGTTTAACCACTGACTGGATGG - Intronic
907711525 1:56887049-56887071 CTGTTCAATGAGTGAGAGGAAGG + Intronic
910089552 1:83446028-83446050 TTCTATTACCAGTCAGAGGATGG + Intergenic
910612483 1:89159846-89159868 GTGTATACCCAGTAATAGGATGG - Intronic
912816268 1:112831218-112831240 CTGTATAGCAAGGGTGAGGACGG + Intergenic
914980892 1:152413419-152413441 CTGGAAAGCCAGAGAGAGGATGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916285076 1:163097774-163097796 TTGTATAATCAGTGTGTGGAGGG - Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
919979307 1:202632465-202632487 CTCTATAACCAGTGGAAGAAAGG + Intronic
920960020 1:210655808-210655830 CTGCAGAAGCAGGGAGAGGAGGG - Intronic
922077516 1:222262446-222262468 CTGAATAACTGGTGTGAGGAAGG + Intergenic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1064448851 10:15423356-15423378 CTGTAAAAACAGTGGGAGGGAGG + Intergenic
1065642182 10:27794471-27794493 CTTTATAAACAGTGTGAGAATGG + Intergenic
1067352040 10:45485157-45485179 CTGCAGAACCAGTGATGGGATGG - Intronic
1069309351 10:67014384-67014406 TTGTATAACCTGTGAGATTATGG + Intronic
1071834989 10:89409612-89409634 ATGTATAACCATTGAGGGGCAGG + Intronic
1072335127 10:94391118-94391140 CTGTATAGCAAGAGTGAGGAAGG + Intergenic
1077526295 11:3067741-3067763 CTGTATACCCAGTGCCAGGAGGG + Intergenic
1078016062 11:7616063-7616085 CTGCATGACCAGTGTCAGGAAGG + Intronic
1078822627 11:14897361-14897383 CTGTAAAACCAGGGAGAGAGGGG - Intergenic
1079091007 11:17480288-17480310 CTGTAGAACCAGTGAAAGAGAGG + Intergenic
1081634980 11:44715054-44715076 CTTTATTAGCAGTGTGAGGATGG - Intergenic
1082279250 11:50253674-50253696 ATGTATAACCAGTAATGGGATGG + Intergenic
1086539356 11:87889246-87889268 CTGTAGAATCAGTCAGAGGGAGG - Intergenic
1088425904 11:109702110-109702132 GTGTATATCCAGTGACAGGATGG - Intergenic
1088438956 11:109846994-109847016 ATGTTTGACCAGTGAGAAGAAGG - Intergenic
1092498160 12:9018747-9018769 TTGTATATCAAGAGAGAGGAGGG - Intergenic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092797249 12:12124565-12124587 CTGTATGACCTATGAGTGGAAGG + Exonic
1095152180 12:38808238-38808260 GTATATAACCAGTAATAGGATGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1100316315 12:93448062-93448084 CAGTAGAATCTGTGAGAGGAAGG + Intergenic
1101780771 12:107832938-107832960 ATGGATAAACAGTGAGTGGACGG + Intergenic
1101831419 12:108260180-108260202 CTGTCTAACCACTGAGATGGTGG + Intergenic
1102618674 12:114176430-114176452 TAGCATAACCATTGAGAGGAAGG - Intergenic
1103224218 12:119273008-119273030 CTGTAAAATGAGTCAGAGGAGGG + Intergenic
1107408010 13:40133118-40133140 CTGTAAAATCAGTGACAGCATGG - Intergenic
1111096777 13:83525946-83525968 CTGTTTAAACCATGAGAGGAAGG + Intergenic
1111372653 13:87336732-87336754 ATGTTTAACCAGTGAGAGCCAGG + Intergenic
1111388008 13:87554584-87554606 TTGTAAAACCAGTAAGAGGTTGG - Intergenic
1111955779 13:94756952-94756974 TTGTATATACAGTGAAAGGAAGG + Intergenic
1112877368 13:104060577-104060599 CTGTATAACAAGTCAAAGAAAGG + Intergenic
1114672866 14:24421566-24421588 ATGTACAACCACTGAGAGGCTGG + Intergenic
1117172774 14:53117490-53117512 CTGCCAAACCAGTGACAGGAGGG - Intronic
1117691336 14:58310588-58310610 TTGTATATCGAGTGAGATGAGGG - Intronic
1118458505 14:65966687-65966709 CTGTGTTATCAGTGAGAGGCTGG - Intronic
1118739194 14:68726404-68726426 CAGTAAAACAATTGAGAGGATGG - Intronic
1118925291 14:70186336-70186358 CTTTATTACCAGTGTGAGAACGG + Intronic
1124494905 15:30180421-30180443 CTCTATAACCAGTGGAAGAAAGG + Intergenic
1124748662 15:32358224-32358246 CTCTATAACCAGTGGAAGAAAGG - Intergenic
1125704985 15:41726242-41726264 ATGTCCAACCAGTGAGAGGCAGG - Intronic
1126107264 15:45154879-45154901 CTGGATCCCCTGTGAGAGGAGGG + Intronic
1126133091 15:45362949-45362971 TGGTATAGCCAGGGAGAGGAAGG + Intronic
1126395877 15:48216761-48216783 ATGTATAATCAATGAGAGCAGGG - Intronic
1129140220 15:73591204-73591226 CTGTGTATCCAGTGATAGCAAGG - Intronic
1130703174 15:86206319-86206341 GTATATACCCAGTGATAGGATGG + Intronic
1131011582 15:89022430-89022452 CTGATCCACCAGTGAGAGGAAGG + Intergenic
1131935118 15:97495459-97495481 GTGTAAAATCAGGGAGAGGAAGG - Intergenic
1135817755 16:25651355-25651377 ATGTAAAATCAATGAGAGGAGGG + Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1153326903 18:3830055-3830077 CTGAACAACCAGTGAGGAGATGG - Intronic
1162765021 19:12913972-12913994 CTGGAGAAGGAGTGAGAGGAGGG - Intronic
1164794816 19:31017338-31017360 CTGTATTAGCAGTGTGAGAATGG - Intergenic
925234784 2:2268304-2268326 CTTAATAATCAGTGAGATGAGGG + Intronic
925473852 2:4191578-4191600 CTTTATTAGCAGTGAGAGAATGG - Intergenic
925571636 2:5318617-5318639 ATGTTTGACCAGTGAGAGGCTGG - Intergenic
927676783 2:25112071-25112093 CAGCATATCCAGTGAGAAGAGGG - Intronic
929111814 2:38411282-38411304 GTGTATACCCAGTAATAGGATGG + Intergenic
930310804 2:49736974-49736996 CTTTATTAGCAGTGTGAGGATGG + Intergenic
930508094 2:52309976-52309998 CTGTGTAATGAGTGAGAGAAAGG + Intergenic
930554815 2:52882605-52882627 GAGAATAACCAGTGAGTGGAAGG + Intergenic
931549746 2:63429820-63429842 GTGTATACCCAGTAATAGGATGG - Intronic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932680852 2:73824155-73824177 CTGTAAAACCAGTAACATGAAGG - Intergenic
934739527 2:96709741-96709763 CTATACAACAAGTAAGAGGATGG + Intronic
935409149 2:102740557-102740579 CTTTATAAGCAGTGCGAGAATGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942338857 2:174921566-174921588 CTTTATTAACAGTGTGAGGATGG - Intronic
943760417 2:191601885-191601907 GTATATAAACAGGGAGAGGAGGG - Intergenic
945863327 2:215148645-215148667 CTGTAAAAGGAGTGAGAGTAGGG + Intergenic
946081658 2:217125319-217125341 CTGTTTACTCAGAGAGAGGAAGG + Intergenic
946429138 2:219615350-219615372 GTGTATCTCCAGTGAGAGGGAGG + Intronic
947277323 2:228407124-228407146 CTGTATTAGCAGTGTGAGAAAGG + Intergenic
948666864 2:239540447-239540469 CTATCTACCCAGCGAGAGGAGGG - Intergenic
1170429384 20:16262631-16262653 CAGAAAAACCAGTCAGAGGATGG + Intergenic
1173071674 20:39774228-39774250 CTTTATAAAAAGTGAGATGATGG - Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1176149379 20:63581510-63581532 CTGTATGTCCAGGGAGAAGAGGG - Intergenic
1183122495 22:35740812-35740834 CTATATAACTAGTTACAGGATGG + Intronic
1184928421 22:47660891-47660913 GTGTATTGCCAGAGAGAGGAGGG - Intergenic
949655206 3:6209992-6210014 TTGTATTACCAGGGAGAGGTAGG + Intergenic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
955049351 3:55394301-55394323 GTATATACCCAGTAAGAGGATGG - Intergenic
956700928 3:71957841-71957863 CTTTATCAGCAGTGTGAGGATGG - Intergenic
957390107 3:79553966-79553988 CTGCATAAACAGTGAGCTGATGG + Intronic
958131141 3:89425422-89425444 CTATATAATCAGTGTCAGGATGG - Intronic
961601251 3:128063902-128063924 CAGAGTAACAAGTGAGAGGAAGG - Intronic
963074497 3:141333551-141333573 ATGCCTAATCAGTGAGAGGAAGG + Intronic
964601940 3:158511628-158511650 CTATATACCCAGTAATAGGATGG + Intronic
964612257 3:158627182-158627204 CTGTAGAACCAGTGAGGGAAGGG - Intergenic
965789766 3:172374747-172374769 CTGTACAATCAGTGAAATGATGG - Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968943053 4:3649105-3649127 CTGTATACCCAGTGTGAACAGGG + Intergenic
970910138 4:21265272-21265294 TTGCATAAGAAGTGAGAGGATGG + Intronic
971996704 4:33974720-33974742 CTGTATTAGCAGTGTGAGAATGG - Intergenic
974587279 4:63895994-63896016 CTGTGAAAACAGTGAGAGGGTGG - Intergenic
976317471 4:83673826-83673848 CTGTGAAAGCAGGGAGAGGAGGG - Intergenic
976553859 4:86427835-86427857 CTTTATAATAATTGAGAGGAGGG - Intronic
976880449 4:89916722-89916744 CTTTAAAATCAGTGAGAAGAAGG - Intronic
978404723 4:108367098-108367120 CTGTAGACCAAGTGAGAGGATGG + Intergenic
979754138 4:124318587-124318609 CTGTATATGCAGTGAGAAAAGGG - Intergenic
984032783 4:174625484-174625506 GTATATAACCAGTGATGGGATGG + Intergenic
988773514 5:34454619-34454641 CTTTATTAGCAGTGAGAGAACGG - Intergenic
989655341 5:43741726-43741748 ATGTATAACCAGTAATGGGATGG + Intergenic
993060331 5:83030586-83030608 CTATTTAAGCAGTGAGAGGCAGG - Intergenic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
998569613 5:143245418-143245440 CTGTATTAGCAGTGTGAGAACGG + Intergenic
1002106361 5:176881209-176881231 CTGGAGAAGCTGTGAGAGGAGGG + Exonic
1003135574 6:3432450-3432472 CTGTAAAACCAGGCAGAGGGAGG + Intronic
1004850126 6:19690811-19690833 GTGTATGACAGGTGAGAGGATGG + Intergenic
1004932933 6:20479229-20479251 CTGTATATTCAATGAGAGAAAGG - Intronic
1005172882 6:23008482-23008504 CTGTAAATTCAGTGAGAGGAAGG - Intergenic
1005719524 6:28587368-28587390 TTGCACAACCAGTGAGAAGACGG - Intronic
1009036066 6:58118097-58118119 TTTCATAACCAGTGAGAGGAAGG + Intergenic
1009211884 6:60871716-60871738 TTTCATAGCCAGTGAGAGGAAGG + Intergenic
1009557648 6:65194660-65194682 CTGTATCCCAAGTGTGAGGAGGG + Intronic
1011892456 6:92182349-92182371 CTCTATAACAAGTGAGATTATGG - Intergenic
1012012878 6:93813209-93813231 CTGTAAACTCAGTGAGAGTAAGG + Intergenic
1012599700 6:101079880-101079902 CTGCATAAACAGTCAGATGAGGG - Intergenic
1013935262 6:115586558-115586580 CTGTATCACCAGTGTGAAAATGG + Intergenic
1014725198 6:124963680-124963702 CTGTATAAGAAATAAGAGGAGGG - Intronic
1016080959 6:139855425-139855447 CTGTTTAAGCAATGAGAAGATGG - Intergenic
1017377096 6:153783795-153783817 TTGTTTAACTAATGAGAGGAAGG + Intergenic
1017574720 6:155789639-155789661 GTGTATACCCAGTAATAGGATGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017848247 6:158278803-158278825 TTGTAGAACCAGTGAAAGGAAGG + Intronic
1021475441 7:21055878-21055900 CTGAAGAACCAGTGACAGCAGGG - Intergenic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1022636946 7:32144908-32144930 CTGTCTATCCAGGGAGAGTAAGG - Intronic
1024405455 7:48974401-48974423 ATATATAACCAGTAATAGGATGG - Intergenic
1024557477 7:50615773-50615795 ATGTATCCCCAGTGAGAAGAAGG - Intronic
1028779649 7:94721342-94721364 CTGTATAAACAGTGAAAGTAAGG + Intergenic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1033431994 7:141297862-141297884 GTGTATACCCAGTAATAGGATGG + Intronic
1034119959 7:148618182-148618204 CTTTATAAGCAGTGTGAGAATGG - Intergenic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1041586682 8:59528918-59528940 CTATAAAACCAGTCAGGGGAGGG - Intergenic
1042411370 8:68470392-68470414 CAGTATAACAAGTGAAAGGCAGG - Intronic
1042423600 8:68620457-68620479 CTGTATTACCAGAGTGAGCAAGG + Intronic
1047530575 8:125670497-125670519 CTGCATAGGCAGTGAGAAGATGG + Intergenic
1047953308 8:129953615-129953637 CTGTATCCCCAGTGAGAGCACGG + Intronic
1048545367 8:135381879-135381901 GTGAAGAGCCAGTGAGAGGAAGG + Intergenic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1055065862 9:72117672-72117694 CATTTTAACCAGTGAGATGAGGG - Intronic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1057077464 9:92146190-92146212 CTGAAAAACCAGGGAGGGGAGGG + Intergenic
1058583839 9:106485919-106485941 CTTTATTAGCAGTGTGAGGATGG + Intergenic
1059078722 9:111223991-111224013 CTGTATATCCAGTAATGGGATGG - Intergenic
1059614641 9:115935616-115935638 CTGTATTAGCAGTGTGAGAATGG + Intergenic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1186649085 X:11539907-11539929 CTGGATAACCAATGAGATTAGGG - Intronic
1190921220 X:54854436-54854458 GTGTATACCCAGTAATAGGATGG + Intergenic
1192008209 X:67240031-67240053 GTGTATAACCAGTAATGGGATGG - Intergenic
1194022645 X:88712022-88712044 CTCTGGAACCTGTGAGAGGAAGG + Intergenic
1195430743 X:104786474-104786496 CTGTAGAACCTCTGCGAGGAAGG + Intronic
1197211635 X:123832777-123832799 CAATATATCCAGTGAGAGGCTGG - Intergenic
1198563949 X:137884120-137884142 GTGTATAACCAGTAACGGGATGG - Intergenic
1201442246 Y:14020992-14021014 CTGTAAAAAAAGGGAGAGGAAGG - Intergenic