ID: 932023414

View in Genome Browser
Species Human (GRCh38)
Location 2:68111408-68111430
Sequence ACACCTACCCTGCTGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932023405_932023414 7 Left 932023405 2:68111378-68111400 CCCTTCACAGTGCCCTCTCCTAC 0: 1
1: 0
2: 1
3: 32
4: 268
Right 932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG 0: 1
1: 1
2: 0
3: 12
4: 131
932023404_932023414 10 Left 932023404 2:68111375-68111397 CCTCCCTTCACAGTGCCCTCTCC 0: 1
1: 0
2: 3
3: 73
4: 517
Right 932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG 0: 1
1: 1
2: 0
3: 12
4: 131
932023408_932023414 -5 Left 932023408 2:68111390-68111412 CCCTCTCCTACACCAGGAACACC 0: 1
1: 0
2: 4
3: 31
4: 267
Right 932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG 0: 1
1: 1
2: 0
3: 12
4: 131
932023406_932023414 6 Left 932023406 2:68111379-68111401 CCTTCACAGTGCCCTCTCCTACA 0: 1
1: 0
2: 0
3: 15
4: 211
Right 932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG 0: 1
1: 1
2: 0
3: 12
4: 131
932023409_932023414 -6 Left 932023409 2:68111391-68111413 CCTCTCCTACACCAGGAACACCT 0: 1
1: 0
2: 3
3: 26
4: 245
Right 932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG 0: 1
1: 1
2: 0
3: 12
4: 131
932023403_932023414 29 Left 932023403 2:68111356-68111378 CCACTGTAATGGCATGTTGCCTC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG 0: 1
1: 1
2: 0
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932023414 Original CRISPR ACACCTACCCTGCTGGTGAT GGG Intergenic
901122859 1:6909453-6909475 ACTGTTACCCTGCTGGAGATGGG - Intronic
901815264 1:11790078-11790100 ACACCTACCATGCTGCTTTTTGG - Exonic
902288487 1:15421772-15421794 ACCCCTGACCTGCTGGTTATGGG + Intronic
903393648 1:22982765-22982787 ACACCTTCCATGCAGGGGATGGG + Intergenic
903671194 1:25036573-25036595 ACCATTACCCTGCTGGTAATTGG + Intergenic
904620300 1:31771217-31771239 ACACCTACGATGCTGGGGTTTGG + Intergenic
904885131 1:33731913-33731935 ACAACCACCCTGCTGGTTCTGGG - Intronic
907054171 1:51349614-51349636 ACTCCTCCCTTGCTGGTGGTTGG - Intergenic
907723952 1:57001364-57001386 TGACCTACCCTGTGGGTGATGGG - Intronic
908439794 1:64142272-64142294 ACAGCTTCCCTGCTGGTCAGGGG - Intronic
911184130 1:94886514-94886536 CCTCCTACCCTGCTGGAGACAGG + Intronic
914764772 1:150628452-150628474 ATACCTACCCTGGTGGTGCAGGG + Intronic
918206290 1:182312414-182312436 ACACCTCCCCTGCTTGTCATGGG + Intergenic
919837273 1:201583487-201583509 ACTCCTTCCCTGCTGGAGATAGG + Intergenic
922289178 1:224196072-224196094 ACACCTGACCTGCTGGGGACTGG - Intergenic
1064194405 10:13233651-13233673 ACCCCCACACTGCTGGTGACAGG - Intronic
1064554660 10:16536232-16536254 ACACCTAAACTGCTTGTTATCGG - Intergenic
1065275102 10:24077799-24077821 ACACATTTCCTGCTGTTGATGGG - Intronic
1066463915 10:35637128-35637150 GCAGCTACCCTGCTAATGATGGG - Intergenic
1070954773 10:80456357-80456379 ACAGCTGCCCAGCTGGTGAAGGG - Intronic
1072240119 10:93488263-93488285 ACAGCTATCCTGGGGGTGATGGG - Intergenic
1073305959 10:102503862-102503884 ACACCTTCCCTGCCTGTGACTGG + Intergenic
1075720401 10:124582586-124582608 ACAGATACCCTGCTGTTGACTGG + Intronic
1076003100 10:126927940-126927962 ACACCTGCCGTGCAGGTGAGGGG + Intronic
1077104993 11:838349-838371 TCACCTCCCCTGCTGGGCATTGG - Exonic
1079943469 11:26711882-26711904 ACCACTACCCTGCTGGAAATAGG + Intronic
1083774780 11:64889040-64889062 ACACCTACTATGCTGGTGGGTGG + Intergenic
1085911312 11:80829956-80829978 ACAAATATCCTGCTGATGATGGG + Intergenic
1099602947 12:84764507-84764529 ACTCAAACCATGCTGGTGATTGG + Intergenic
1099690497 12:85945836-85945858 ACACTTACTCTGATGGTGTTAGG - Intergenic
1105817559 13:24051042-24051064 ACAGCTACCCAGCTGGTGGATGG - Intronic
1115135600 14:30103967-30103989 ACTACTACCCTGCTGATGATCGG - Intronic
1118316337 14:64728361-64728383 ACACCTACCTTGTAGGTGAAGGG + Intronic
1121245829 14:92460211-92460233 AGACTCACCCTGCTGGTGAGTGG - Intronic
1121612993 14:95293963-95293985 GCACCTTCCCTGCTGGCGTTTGG - Intronic
1121871334 14:97410692-97410714 AAACTTACCCTCGTGGTGATAGG - Intergenic
1121961453 14:98264040-98264062 GCATCTCCCTTGCTGGTGATGGG + Intergenic
1122818964 14:104331653-104331675 ACACCTGCTGTGCTGGAGATAGG - Intergenic
1124022431 15:25937013-25937035 GCACCGAACCTGCTGGTGCTTGG + Intergenic
1125428749 15:39575712-39575734 ACACATACCCTGCTCTTAATTGG + Intergenic
1129976822 15:79829727-79829749 ACACTTACCCTGCAGGTCAAAGG + Intergenic
1131272413 15:90955263-90955285 TCACCGCCCTTGCTGGTGATTGG + Intronic
1132010057 15:98267694-98267716 ACCACCACCCTGCTGGTTATGGG + Intergenic
1132204772 15:99978698-99978720 ACTCCCGCCCTGCTGGTGTTGGG + Intronic
1132937725 16:2490007-2490029 GCACCTACTCTGCTGGTGTCTGG + Intronic
1138764391 16:59584014-59584036 ATACCTACCCTGATGGTGTTAGG - Intergenic
1139968061 16:70756513-70756535 GCGCCTACCCTGCTGGTGAGGGG + Intronic
1141621787 16:85240296-85240318 ACACCTTCCCTGCTGGTTCTGGG + Intergenic
1141787987 16:86214447-86214469 ACACCTATGCTGCTGGTGTGGGG - Intergenic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1147321268 17:39647469-39647491 ACACCCACCCTCCTGATGAGGGG - Intronic
1148439627 17:47705061-47705083 ACCCCTTCCCTGGGGGTGATAGG - Intronic
1151357354 17:73567735-73567757 ACACCTGCCCTGCTGGGTTTCGG + Intronic
1156657300 18:39303828-39303850 ACTCCAATCCTGCTGGTTATGGG - Intergenic
1157528999 18:48406310-48406332 ACACCGCCCCTGCTGGAGAGGGG + Intronic
1157878241 18:51293969-51293991 TCACCTATCCTGCTGCTGCTAGG - Intergenic
1158288212 18:55908702-55908724 CCTCCTACCCTGAGGGTGATTGG + Intergenic
1158326382 18:56317991-56318013 ATCCCTACACTGCTGGTGAGGGG - Intergenic
1158568746 18:58578653-58578675 ACAAGTACCCTGATGGTGTTGGG + Intronic
1162249682 19:9431546-9431568 ACACTCACACTGATGGTGATGGG - Intronic
1163353136 19:16792200-16792222 CCACCTGCCCTGTTGGTGGTTGG + Intronic
1163559211 19:18009104-18009126 ACGCCAGCCCTGCTGGTGAGTGG + Exonic
1163755601 19:19104650-19104672 ACACCTTCCCTGCAGGGGTTTGG + Intronic
924992051 2:320658-320680 AAACCTAGCCTGCTGGTCCTGGG + Intergenic
925342237 2:3145680-3145702 CCACCTACCCTGCTGGAGAGGGG - Intergenic
927424256 2:22963450-22963472 ACACCTAAGCTGCTGTTGTTGGG - Intergenic
932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG + Intergenic
938440291 2:131324322-131324344 ACACTTTCCCTGCTATTGATAGG - Intronic
939165339 2:138635404-138635426 ATACCTACCTTGCTGTGGATTGG - Intergenic
942494096 2:176520837-176520859 ACACCTGCCCTGGTGGGGCTGGG + Intergenic
942767201 2:179470547-179470569 AAACCTAGCATGCTGGTGAAAGG + Intronic
945568102 2:211429503-211429525 CCACATATCCTGCTGATGATGGG + Intronic
948723217 2:239916657-239916679 ACACCAAACCTGCTGGTGCCTGG - Intronic
1169206013 20:3740767-3740789 ATACCTACCCTGCTTGTGCCAGG + Intronic
1170308245 20:14963579-14963601 ACACATTCCCTGCCGGTGGTGGG + Intronic
1174276004 20:49404726-49404748 ACACCTACCTTGCTGGTGATGGG + Intronic
1174648891 20:52107751-52107773 TCACCTACTCTCCTGTTGATGGG + Intronic
1174780156 20:53382248-53382270 ATTCCTTCCCTGCTGGTGCTGGG + Intronic
1175248221 20:57593925-57593947 ACCCCTACCCTGGTGGAGACAGG + Intergenic
1175431019 20:58903176-58903198 ACCCCTACCCAGATGTTGATAGG + Intronic
1178263097 21:31117809-31117831 ACACCGACGCTGCTGGTGTCAGG + Intergenic
1179171098 21:38973405-38973427 AAACCCACTCTGCTGGTCATGGG - Intergenic
1181961624 22:26625863-26625885 ACAGCAACCCTGGTTGTGATAGG + Intronic
1184677447 22:46051389-46051411 ACACCCACCCTCCTGCTCATGGG - Exonic
960517528 3:118618490-118618512 ACACATACCATGCTGGTGCCAGG - Intergenic
961008786 3:123422742-123422764 AGACCAAGCCTGCTGCTGATGGG - Intronic
961113945 3:124312614-124312636 ACACCAACACTGGTGGTGTTAGG + Intronic
966925520 3:184642358-184642380 ACATCTACCCTGTGCGTGATAGG - Intronic
969511626 4:7621105-7621127 GCACCTCCCCTGCTGGGGGTAGG + Intronic
970408738 4:15787424-15787446 CCACCTGCCATGCTGGTGTTTGG + Intronic
977280665 4:95035902-95035924 ATACATACCATGCTGGTGAATGG - Intronic
977750682 4:100606870-100606892 ACACTTACCCTGCCTGTGATAGG + Intronic
983356012 4:166657944-166657966 ATAGCTACTCTGCTGGTGAAAGG - Intergenic
985348588 4:189034205-189034227 ACACCTCACCTGCTGGTTATAGG + Intergenic
990200672 5:53369108-53369130 GCACCTCCCTTGCTGTTGATTGG - Intergenic
991571345 5:68056751-68056773 ACACCAACCATGCTTGTAATAGG - Intergenic
992648327 5:78833029-78833051 ACACCTATCCTGCAGGTGCCGGG - Intronic
993745815 5:91595650-91595672 CCACCTACTCTTCTGGGGATGGG + Intergenic
998741996 5:145214410-145214432 ACACCTTCCATGCTTGTGGTTGG + Intergenic
999068668 5:148718717-148718739 ACACCTACCCCAGTGGTCATGGG - Intergenic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
1000975470 5:167759686-167759708 ACACCTACCCTGCTGGAAGGGGG - Intronic
1002197961 5:177511436-177511458 ACACCTGGCCTGCTGGTACTTGG - Intergenic
1007329150 6:41090295-41090317 ACACTTACCTTGCTGGAGAATGG - Exonic
1008221401 6:48858108-48858130 ACAACTAGCCTGCTGGAGAGAGG - Intergenic
1016588191 6:145713610-145713632 ACTCATACACTGCTGGTGAGTGG + Intronic
1017266822 6:152455772-152455794 ACGCCTTACCTGCTGGTGTTTGG - Intronic
1018428496 6:163704403-163704425 ACACCAAATCTGCTGGTGCTTGG + Intergenic
1019126628 6:169845149-169845171 ACACCTGCCCTCCTGGAGCTTGG + Intergenic
1020192563 7:6011277-6011299 TCTTCTACCCTGCTGGTGAGCGG - Intronic
1021252836 7:18352998-18353020 ACAAATACCCTGCTAGTTATTGG + Intronic
1023198769 7:37670551-37670573 ACATCCTCCTTGCTGGTGATTGG - Intergenic
1026658675 7:72279441-72279463 ACACCTGCCCTGCTGGAAACAGG + Intronic
1028416708 7:90588255-90588277 AAACCAACCCAGCTGGTGAGTGG - Intronic
1031997634 7:128243009-128243031 ACTCCTACCCCGGTGGGGATGGG - Intronic
1033725271 7:144109685-144109707 ACACTCACCCTGCTGGGGAATGG + Exonic
1033726944 7:144129215-144129237 ACACTCACCCTGCTGGGGAATGG + Exonic
1035175193 7:157045337-157045359 GCCCCTAGCCTGCTGGTGAGGGG - Intergenic
1036446677 8:8827409-8827431 ATACCCACCTTGCTGGTGAAAGG - Intronic
1037748352 8:21663760-21663782 ACACACACCCTGCAGGTGGTAGG + Intergenic
1037935431 8:22912293-22912315 ACCCCTGCCCTGCCTGTGATGGG - Intronic
1039108628 8:34017828-34017850 GCAGAAACCCTGCTGGTGATGGG + Intergenic
1041391157 8:57348731-57348753 ACATCTAACCCCCTGGTGATGGG - Intergenic
1045906110 8:107347003-107347025 ACGGCTACCATGCTGGAGATAGG - Exonic
1049230183 8:141477849-141477871 ACAGCCACCCTGATGCTGATGGG - Intergenic
1051858892 9:21601484-21601506 ACACAAACCCTGCGGGTGAGAGG - Intergenic
1054971251 9:71090166-71090188 AAACCTACCTTGATGGTGAGGGG + Intronic
1055054932 9:72014803-72014825 ACACCTACATGGCTGCTGATAGG - Intergenic
1060280028 9:122209560-122209582 AGAGCCACCCTGCTGGGGATGGG - Intronic
1060523875 9:124309529-124309551 CCAGCTGCACTGCTGGTGATGGG - Intronic
1061176933 9:129003236-129003258 ACACCTACCCTCCTGTGGAGAGG - Intronic
1061649712 9:132037678-132037700 GGAGCTACCCTGCTGGTGATGGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062615282 9:137393413-137393435 ACACCTGCCCCTCTGGGGATGGG - Intronic
1187224216 X:17360279-17360301 TCACTTATCCTGCTGCTGATGGG + Intergenic
1188560587 X:31464244-31464266 ACAGCTACTCTTCTGGTCATGGG - Intronic
1189371633 X:40433759-40433781 AGACCTCCCCTGCTGGGGATGGG + Intergenic
1192013017 X:67295647-67295669 AAACCTAGCCTCCTGCTGATAGG + Intergenic
1192560977 X:72127748-72127770 ACTCCTGCCCTGGTGGGGATGGG + Exonic
1192941503 X:75917661-75917683 ACACTTACCCTGCTGGTGCCTGG + Intergenic
1195849265 X:109265160-109265182 ACACCACCCCTGCTGGAGGTTGG + Intergenic
1199350902 X:146798584-146798606 ATACTTAACCTGCTGGTGAAAGG + Intergenic
1202231623 Y:22664622-22664644 GCAACTACCCTGCTGGGGAAAGG + Intergenic
1202311535 Y:23531543-23531565 GCAACTACCCTGCTGGGGAAAGG - Intergenic
1202559267 Y:26139051-26139073 GCAACTACCCTGCTGGGGAAAGG + Intergenic