ID: 932029298

View in Genome Browser
Species Human (GRCh38)
Location 2:68166907-68166929
Sequence GGGTTTCAAGATATGGATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 3, 1: 16, 2: 55, 3: 110, 4: 620}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932029298_932029300 -5 Left 932029298 2:68166907-68166929 CCGTGATCCATATCTTGAAACCC 0: 3
1: 16
2: 55
3: 110
4: 620
Right 932029300 2:68166925-68166947 AACCCTTCACCCCTCACTTTTGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932029298 Original CRISPR GGGTTTCAAGATATGGATCA CGG (reversed) Intronic
900328206 1:2121365-2121387 GGGCTTCAACATATGGATTCTGG - Intronic
900674908 1:3879399-3879421 GGGTTTCAACATACGAATCTTGG - Intronic
901527481 1:9832883-9832905 GGGTTTCACCATATTGACCATGG - Intergenic
902355920 1:15900036-15900058 GGGTTTCAGCATATTGGTCAGGG + Intronic
903451826 1:23458788-23458810 AGGTTTCAAGATGGGGATCAAGG - Intronic
905566415 1:38968704-38968726 GGATTCCAAGATATAGATCTTGG - Intergenic
906863191 1:49384397-49384419 GGGTTTCACCATATTGGTCAGGG - Intronic
907646692 1:56251704-56251726 GGGTTTCAACATATGAATTTGGG - Intergenic
907945375 1:59131300-59131322 GGATTTCAACATATGGATTTGGG - Intergenic
908181689 1:61612221-61612243 GGATTTCAAAATATAGATCTTGG - Intergenic
908193362 1:61725537-61725559 GGGTTTACAGATAAGGAACAAGG + Intergenic
908275577 1:62467302-62467324 GGGTTTCAAGATATGGATCTTGG + Intronic
908379623 1:63583972-63583994 AGGTTTTAAGATATGGATCTTGG + Intronic
908474832 1:64477331-64477353 GGTTTTTAAGATATGGTTCACGG + Intronic
908810265 1:67975051-67975073 AGGTTTCAACATATGGATTTTGG + Intergenic
908815811 1:68032786-68032808 GAATTTCAAGATACGGATCTTGG - Intergenic
908850559 1:68371639-68371661 GGGTTTCAATATATGAATTTTGG + Intergenic
908950862 1:69561437-69561459 GGGTTTCACCATATTGGTCAGGG - Intergenic
909025647 1:70478713-70478735 GGGCTTCAACATATGGATTTTGG + Intergenic
909046091 1:70711612-70711634 GGATTTCAGGATATGGATCTTGG + Intergenic
909079809 1:71096509-71096531 GGGTTTCAACATATGAATTTTGG - Intergenic
909167665 1:72249034-72249056 GGGTTTCAACATATGAATTTTGG - Intronic
909351140 1:74654709-74654731 GGGTTTCAACATATGAATTTTGG + Intronic
909365936 1:74822021-74822043 AGGTTTCAACATATGAATCTGGG + Intergenic
909556931 1:76964391-76964413 GGGTTTCATGCTATGGGCCATGG - Intronic
910010090 1:82451101-82451123 GGGTTTCAACATATGAATTTTGG + Intergenic
910028496 1:82687560-82687582 GGGTTTTAAGAGTTGGATCTTGG + Intergenic
910173622 1:84404261-84404283 GGATTTCAAGATATGATTCCTGG - Intronic
910484440 1:87697242-87697264 GGGTTTCAAGATTTGGATCTTGG + Intergenic
910956786 1:92715198-92715220 GGGTTTCACCATATTGGTCAGGG + Intronic
911381882 1:97125593-97125615 GGGTTTCAATATATGAATTGGGG - Intronic
911493076 1:98593471-98593493 AAGTTTCAAGATATGGATCTTGG + Intergenic
911521984 1:98940433-98940455 GGGCTTCAACATATGAATCAAGG + Intronic
911870692 1:103094158-103094180 GGGTTTCAAGATATGGATCTTGG + Intronic
911979283 1:104545811-104545833 GGGATTCAACATATGGATTGTGG - Intergenic
912309821 1:108609059-108609081 GGGTTTCAACATATGAATTTTGG + Intronic
912841179 1:113040890-113040912 GGGTTTCAAGATACAGATCTTGG + Intergenic
913647204 1:120869549-120869571 GGGTTGCAAGATATGGATCTTGG + Intergenic
914079438 1:144393313-144393335 GGGTTGTAAGATATGGATCTTGG - Intergenic
914099741 1:144573189-144573211 GGGTTGTAAGATATGGATCTTGG + Intergenic
914174337 1:145261859-145261881 GGGTTGTAAGATATGGATCTTGG - Intergenic
914299248 1:146364492-146364514 GGGTTGCAAGATATGGATCTTGG - Intergenic
914529005 1:148503035-148503057 GGGTTGCAAGATATGGATCTTGG - Intergenic
914637387 1:149564065-149564087 GGGTTGCAAGATATGGATCTTGG + Intergenic
915261892 1:154682805-154682827 GGGCTTCAACATATGGATTTGGG - Intergenic
915500638 1:156314357-156314379 GGGTTTCAAGATATGAATCTTGG + Intronic
915800381 1:158785437-158785459 GGCTTTCAAGAGAAGGATCTAGG - Intergenic
915851937 1:159333469-159333491 GGGTTTCAAGATATGGATCTCGG - Intergenic
915878345 1:159637549-159637571 GGGTTTCAAGATATGAATTTTGG - Intergenic
916077818 1:161212749-161212771 GGGTTTCACCATATTGGTCAGGG + Intronic
916086060 1:161270435-161270457 GGATTTCAATATATGGATTTTGG - Intronic
916319583 1:163488879-163488901 AGGTTTCAAGATAGAGATAATGG - Intergenic
916883521 1:169045417-169045439 GGGTTTCAAAGTAGGCATCAGGG - Intergenic
917025504 1:170637451-170637473 GTGCTTCAAGATATGGATCTTGG + Intergenic
917071569 1:171157070-171157092 GGGTTTCAAGATATGGATCATGG + Intronic
917824232 1:178800015-178800037 GAGTTTCAAGATACGGATCTTGG + Intronic
917824390 1:178801730-178801752 GAGTTTCGAGATATGGATCTTGG + Intronic
917866150 1:179197674-179197696 GGATTTCACCATATTGATCAAGG - Intronic
917995158 1:180430369-180430391 GGGTTTGAAGAGATGGTTGAGGG - Intronic
918119664 1:181527393-181527415 AGGTTTCAACATATGGATTTTGG + Intronic
918180062 1:182079673-182079695 GGATTTCAAGATGAGGATCTTGG + Intergenic
918601314 1:186365829-186365851 GGGTTTCAAGATACGGACCTTGG + Intronic
918629158 1:186695047-186695069 GGGTTTCAAGATATGGATCTTGG + Intergenic
918953604 1:191174822-191174844 GAGTTTCAAGATATGGATCTTGG - Intergenic
919029479 1:192222138-192222160 GGGTTTCAAGTTATAGATCTTGG + Intergenic
919325036 1:196096998-196097020 GGCTTTCTAGGTATGGATCTTGG - Intergenic
920618083 1:207514370-207514392 GGATTTCAACATATGGATTTGGG - Intronic
922456320 1:225776597-225776619 GGGTTTCACGATGTTGACCAGGG + Intergenic
922995185 1:229951758-229951780 GGGTTTCAACATATGAATTTGGG + Intergenic
923399608 1:233603634-233603656 GGGTTTCCAGATGTGGGTCTTGG - Intergenic
923681523 1:236122408-236122430 GGGTTTCAAATGATGAATCAGGG + Intergenic
923934173 1:238743262-238743284 GGGTGTCAGAATATGGATCTTGG - Intergenic
924366825 1:243303069-243303091 GGGTTTCAAGATAGAGATCTTGG + Intronic
1062771059 10:101408-101430 GGGCTTCAAGATATGAATTTTGG - Intergenic
1063518878 10:6722936-6722958 GGATTTCAAGATATGAATTTTGG - Intergenic
1064218808 10:13421992-13422014 GGATTTCAACATATGGATTCTGG + Intergenic
1064486871 10:15801848-15801870 GGGTTTCAAGATAAAGATCTTGG + Intronic
1064491738 10:15865161-15865183 GGGCTTCAATATATGGATTTTGG - Intergenic
1064816353 10:19269188-19269210 AGGTTTCAAGATATGAATTGTGG - Intronic
1064829889 10:19450994-19451016 GGATTTCAACATATGAATGAAGG + Intronic
1064856276 10:19771649-19771671 AGTTTTCAAGAAATGCATCATGG - Intronic
1064961349 10:20968202-20968224 GGGATTCCAAATATGGATTAGGG + Intronic
1065510146 10:26470342-26470364 GGGTTTCACCATATTGGTCAGGG - Intronic
1065863498 10:29892433-29892455 GGATTTCAACATATGAATCTTGG - Intergenic
1066458305 10:35590881-35590903 GGATTTCAACATATGGATTTGGG + Intergenic
1066586892 10:36945458-36945480 GGGTTTCAAGATATGAATTTTGG + Intergenic
1067025538 10:42840636-42840658 GGCTTTCAGGATATGGATCTTGG - Intergenic
1067171677 10:43912156-43912178 AGGTTTCAACATATGGATTCTGG + Intergenic
1067549816 10:47226382-47226404 GGGCTTCAACATATGGATTTGGG + Intergenic
1067659464 10:48223702-48223724 GGGTTTCAACATATGGATTTGGG - Intronic
1068063760 10:52102624-52102646 GGGTTTCAAGATAGGGATCTTGG + Intronic
1068298192 10:55103412-55103434 GGGTTTCAAAATATGGATCTTGG - Intronic
1068806401 10:61199095-61199117 GAGTTTCAAAATATGGATCTTGG - Intergenic
1068841461 10:61619542-61619564 GGGTTTCAACATATGAATTGTGG - Intergenic
1069213135 10:65786772-65786794 GGGTTTCAACATATGAATTTGGG + Intergenic
1069302139 10:66921316-66921338 GGGTTTCAATATATGGCTTTTGG + Intronic
1069635142 10:69920439-69920461 GGGCTTCAACATATGGGTCTGGG - Intronic
1069733248 10:70632956-70632978 GGGTTTCAAGATATGGATCTTGG + Intergenic
1070027961 10:72650260-72650282 GGGCTTCAACATATGGATGGTGG - Intergenic
1070164079 10:73884751-73884773 GGGTTTCACCATATTGGTCAGGG - Intergenic
1070225918 10:74505479-74505501 GAGTTTCAAGATACGGATCTTGG - Intronic
1071548758 10:86549613-86549635 GGGTTTCAACATATGAATTTTGG - Intergenic
1071558182 10:86622955-86622977 GGATTTCAAGATATGAATATTGG - Intergenic
1073912934 10:108367758-108367780 GGGTTTCACCATGTTGATCAGGG - Intergenic
1074632779 10:115276284-115276306 GGGTTTCAAAATATGAATTTTGG + Intronic
1074955844 10:118388472-118388494 GGGCTTCAACATATGGATTTTGG - Intergenic
1075100660 10:119503923-119503945 GGACTTCAACATATGGATTAGGG + Intronic
1076350835 10:129814233-129814255 GGGTTTCAACATATGAATTTGGG - Intergenic
1077628245 11:3792416-3792438 GGGTTTCAACATGTTGACCATGG - Intronic
1078023768 11:7674916-7674938 GGGCTTCAACATAAGAATCAGGG + Intronic
1078472617 11:11603885-11603907 GGATTTCAACATATGGATTTGGG - Intronic
1078793012 11:14563577-14563599 GGTTTTCAAGCAATGGATTAAGG + Intronic
1078837503 11:15045138-15045160 GGGCTTCAACATATGAATCTCGG + Intronic
1078867697 11:15313145-15313167 GGGTTTCAACATATGAATTTTGG - Intergenic
1079634210 11:22715265-22715287 GGGTTTCAAAATGTTGTTCATGG - Intronic
1079908060 11:26273697-26273719 GGATTTCAAGATGTGAATCTTGG + Intergenic
1080121766 11:28686154-28686176 AGGTTTCAAGATAGAGATCTTGG - Intergenic
1080149716 11:29036659-29036681 GGGTTTTAAGATAGGGATCTTGG + Intergenic
1080231756 11:30024184-30024206 GGGCTTCAACATATGGATTTTGG - Intergenic
1080308838 11:30866539-30866561 GGGTTTCAACATATGAATTTTGG + Intronic
1080406139 11:31981008-31981030 GAGTTTCAACATATGAATCTGGG + Intronic
1081057750 11:38431578-38431600 GGGCTTCAAAATATGAATCCTGG - Intergenic
1081658168 11:44871436-44871458 GGGTTTCAATATATGAATTTGGG + Intronic
1081949680 11:47033533-47033555 GGGTCCCAAGATATGGATCTTGG - Intronic
1082030511 11:47600134-47600156 GGGTTTCAAGAGAGAGATCCAGG - Intergenic
1082234049 11:49800995-49801017 GGGTTTCAGAATATGGATCTTGG + Intergenic
1083482888 11:62961060-62961082 GGGCTTCAACATATGAATGAGGG - Intronic
1085074589 11:73579194-73579216 GGGTTTCAACATATGAATTTTGG + Intronic
1085489405 11:76900842-76900864 GGGTTTCAAGATATGAACCTTGG - Intronic
1085598116 11:77829037-77829059 GGGCTTCAACATATGAATCTGGG - Intronic
1085871908 11:80360220-80360242 GAGTTTCAAGATATGGATCTTGG - Intergenic
1086051850 11:82601387-82601409 GGATTTCAACATATGGATTTAGG + Intergenic
1086426496 11:86688865-86688887 GGGTTTCAACATATGAATTTGGG + Intergenic
1086617540 11:88840444-88840466 GGGTTTCAGAATATGGATCTTGG - Intronic
1086737770 11:90328451-90328473 GGGTTTCAACATATGAATTTTGG - Intergenic
1087161585 11:94953487-94953509 GGGTTTCAAGATGTGGATCTTGG - Intergenic
1087174067 11:95080105-95080127 GGGTTTCAACATATGAATTTTGG - Intergenic
1087207834 11:95416103-95416125 GTGTTCCAAGAAATGGGTCAGGG - Intergenic
1087325699 11:96720726-96720748 GGATTTCACGATATGGATCTTGG + Intergenic
1087334563 11:96826857-96826879 GGGATTCAACATATGGATTTTGG + Intergenic
1087823400 11:102737140-102737162 GGATTTAAAGATTTGGTTCAGGG - Intergenic
1087908928 11:103730080-103730102 GGGTTTCATTATATGAATTATGG + Intergenic
1088875176 11:113929597-113929619 GGGTTTCAACATATGGGTTTTGG + Intronic
1089115828 11:116094310-116094332 GGGTTTCAACATATGGATTAGGG - Intergenic
1089249453 11:117147074-117147096 GGGTTTCATCATATTGGTCAGGG - Intronic
1091088013 11:132742252-132742274 GGGTTTCAACATATGAATTTTGG - Intronic
1091858456 12:3757525-3757547 AGGTTAGAAGATATGGATCCAGG - Intronic
1092281922 12:7104184-7104206 GGGAATCAAGATAGGGATGAGGG + Intronic
1093256231 12:16871639-16871661 GAGTTTCAAGATAGAGACCAAGG + Intergenic
1093588143 12:20867458-20867480 GAATTTCAAGACATGGATCTTGG + Intronic
1093601380 12:21028479-21028501 GAATTTCAAAATATGGATCTTGG + Intronic
1094216508 12:27948403-27948425 GGGTTTCAATATATGAAAAAAGG - Intergenic
1095379660 12:41575206-41575228 GGGTTTCAACATATGAATTTTGG + Intergenic
1095933531 12:47652825-47652847 GGATTTCAACATATGGATTTTGG + Intergenic
1096244474 12:49976426-49976448 GGGTTTCATCATATTGGTCAGGG + Exonic
1096521462 12:52186981-52187003 GCCTTTCAAGATATGAGTCATGG - Intronic
1096724982 12:53554321-53554343 GGGTTTCACCATATTGGTCAGGG + Intronic
1096940376 12:55338011-55338033 GGATTTCAAGATATGCATCTTGG - Intergenic
1097110756 12:56656274-56656296 GGGTTTCAACATATTGCCCATGG + Intergenic
1097452143 12:59749815-59749837 GGACTTCAAGATATGGATCTTGG + Intronic
1098214959 12:68206005-68206027 AGATATCAAGATATGGATCTTGG - Intronic
1098300459 12:69048674-69048696 GGGTTTCAACATATGAATTTTGG + Intergenic
1098547387 12:71726932-71726954 GGGCTTCAACATATGGATTTTGG - Intergenic
1098772658 12:74573888-74573910 TGATTTCAAGATATGAATCCTGG + Intergenic
1099109314 12:78537633-78537655 GGATTTCAACATATGGATTTTGG + Intergenic
1099109803 12:78544460-78544482 GGGTTTCAACATATGAATTGTGG - Intergenic
1100886082 12:99071837-99071859 GGGTTTCAACATATTGGCCAGGG + Intronic
1101471970 12:105006043-105006065 GGGTTTCAAGACAGGGATCTTGG - Intronic
1101614118 12:106319316-106319338 GGGTTTCAACATATGAATTTGGG + Intronic
1101743773 12:107522240-107522262 GGGCTTCAACATATGGATTTGGG + Intronic
1102111373 12:110367779-110367801 GGGTTTCACCATATTGGTCAGGG - Intergenic
1102131541 12:110533915-110533937 GGGTTTCAAGCTTTGCATGATGG - Exonic
1102164670 12:110796833-110796855 GGGATTCAAGAGAAGAATCAAGG + Intergenic
1102487966 12:113270888-113270910 GGATTTCAACATAGGGATTAGGG + Intronic
1102745544 12:115245819-115245841 GGGTTTCAACGTATGAATCTGGG - Intergenic
1103222149 12:119254870-119254892 GGATTTCAACATATGGATTTGGG + Intergenic
1103284026 12:119785280-119785302 GGGATTTAAGTTATGGATCTTGG + Intronic
1103300983 12:119926555-119926577 AGGTTTCAACATATGGATTGAGG - Intergenic
1103442695 12:120975277-120975299 GGGTTTCACCATATTGGTCAGGG + Intergenic
1104788198 12:131464921-131464943 GAATTTCAAGATATGGATCTTGG + Intergenic
1104837091 12:131798695-131798717 GGGTTTCACCATATTGGTCAGGG - Intronic
1105309706 13:19195544-19195566 GGGTTTCACCATATTGGTCAGGG - Intergenic
1105527798 13:21192074-21192096 GGGTTTCACCATATTGGTCAGGG + Intergenic
1106034697 13:26033213-26033235 GGGTTTTAACATATGAATCCGGG - Intergenic
1106193681 13:27475699-27475721 GGGGTTCTGGAGATGGATCATGG - Intergenic
1106609973 13:31269647-31269669 AGGTTTCAAGGTATGAATTAGGG - Intronic
1107386998 13:39921702-39921724 GTGTTTCAAGATATTGGTCTGGG - Intergenic
1107494386 13:40910563-40910585 GGGTTTTCAAATATGTATCAAGG + Intergenic
1107536464 13:41339750-41339772 GGGTTTCATGATGTTGACCAGGG + Intronic
1109436707 13:62313111-62313133 GGATTTCAACATATGGATTTTGG - Intergenic
1109687558 13:65841954-65841976 GGATTTCAAGATATGAATTTTGG - Intergenic
1110161917 13:72388773-72388795 GGATTTCAAAATATGGATTTTGG - Intergenic
1110177321 13:72573006-72573028 GGGTTTCAACATATGAATTTTGG - Intergenic
1110351003 13:74507420-74507442 GGGTTTCACCATATTGGTCAGGG - Intergenic
1110989034 13:82013248-82013270 GGTTTTCAGGCTATGGAACAAGG + Intergenic
1111563656 13:89986151-89986173 GGGTTTCAACATATGAATTTGGG - Intergenic
1111901034 13:94199962-94199984 GGGTTTCACCATATTGGTCAGGG - Intronic
1112400329 13:99072004-99072026 GGGTTTCAAGATAAAGACCTTGG - Intronic
1112512996 13:100026508-100026530 GGGTTTTAAGATATGGATCTTGG + Intergenic
1112961507 13:105132927-105132949 GGGTTTCAACATATGAATGTTGG + Intergenic
1115106641 14:29769904-29769926 AGGTTTCAACATATGAATTATGG - Intronic
1115563992 14:34608834-34608856 GGGTTTCACCTTATTGATCAGGG - Intronic
1115613672 14:35072816-35072838 GCGTTTCAAAATTTGGATCTCGG - Intronic
1115623863 14:35169978-35170000 GAGCTTCAAGATGTGGATAAAGG - Intronic
1116046484 14:39749742-39749764 GGGTTTCACCATGTTGATCAGGG + Intergenic
1116129712 14:40839302-40839324 GGGTTTCAAGTTATGAATCTTGG + Intergenic
1116216575 14:42024679-42024701 GGGTTTCAACATATAAATCTGGG + Intergenic
1116317033 14:43410518-43410540 GGGTTTCACCATATTGGTCAGGG + Intergenic
1116445117 14:45000189-45000211 GAGTTTCACCATATTGATCAGGG + Intronic
1116478002 14:45364383-45364405 GGGTTTCAAAATTTGCTTCATGG - Intergenic
1116528843 14:45941186-45941208 AGGTTTCAACATATGGATTTTGG + Intergenic
1116599094 14:46895531-46895553 GGGTTTCACCATATTGACCAGGG - Intronic
1118285993 14:64473477-64473499 GGCATTAAAGATATGGATCATGG + Exonic
1118405699 14:65421708-65421730 GGGTTTCAAGATACAAATCTTGG - Intronic
1119092314 14:71796115-71796137 GGATTTCAAGAGATAGATCTGGG + Intergenic
1119148719 14:72339134-72339156 GGGTTTCAACATATGAATTTTGG - Intronic
1119724312 14:76913053-76913075 GGGTTTCACCATATTGACCAGGG - Intergenic
1119873655 14:78038024-78038046 GGGTTTCAAAATATGAATTTGGG - Intergenic
1120493721 14:85207679-85207701 AGGTTTCAACATAAGAATCAGGG + Intergenic
1120608286 14:86606958-86606980 GGGTTTCAACATATGAATTTTGG - Intergenic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1120824572 14:88943819-88943841 AGGTTTCAACATATGAATCTTGG + Intergenic
1121004289 14:90478612-90478634 GAGTTTCAAGATATGCATCTTGG - Intergenic
1121177885 14:91904797-91904819 GGGCTTCAACATATGGATTTGGG + Intronic
1121818522 14:96946487-96946509 GGATTTCAACATATGGATTTTGG + Intergenic
1122525228 14:102377511-102377533 GGGTTTCACCATATTGGTCAAGG - Intronic
1123426160 15:20172088-20172110 GGCTTTCAGGATATGGATCTTGG - Intergenic
1123535393 15:21178615-21178637 GGCTTTCAGGATATGGATCTTGG - Intergenic
1125120695 15:36155389-36155411 GGGTTTCAACATATGAATTTTGG + Intergenic
1125159788 15:36629712-36629734 GGCTTTCAAGATTTTAATCATGG - Intronic
1125311642 15:38385529-38385551 GGGTTTCAAGATACGGATCTAGG + Intergenic
1125456190 15:39861355-39861377 GGGTTTCACCATGTTGATCAGGG - Intronic
1126204999 15:46035441-46035463 GGGCTTCAACATATGGAACTGGG - Intergenic
1126238095 15:46409111-46409133 GGATTTCAACATATGGAGAAAGG - Intergenic
1128139726 15:65290498-65290520 AGGGTTCAAGATATGAATCTTGG + Intronic
1128551938 15:68603527-68603549 GGGCTTCAACATATGAATTAGGG - Intronic
1129464835 15:75718235-75718257 GGGTTTCACCATATTGGTCAGGG + Intergenic
1130009175 15:80134666-80134688 GGATTTCAAGATAGGGATCTTGG + Intronic
1130358431 15:83156995-83157017 GGGTTCTAAGAAATGCATCATGG - Intronic
1131214680 15:90527319-90527341 GGGTTTCACCATATTGGTCAGGG + Intergenic
1131375727 15:91921379-91921401 GGGCTTCAATATATGAATCTGGG + Intronic
1131579327 15:93626649-93626671 GAGTTTCAAGATACAGATCTTGG - Intergenic
1132482777 16:174842-174864 GGGTTTCTACATGTTGATCAGGG - Intergenic
1133345935 16:5070475-5070497 GGGTTTCAAGGTCTGGCTTAAGG + Intronic
1133994037 16:10733496-10733518 GGGCTTCAACATATGAATCTGGG + Intergenic
1134894321 16:17871152-17871174 AGGTTTCAACATATGAATCTAGG + Intergenic
1135097604 16:19577643-19577665 GGATTTCAACATATGAATCGGGG - Intronic
1135223223 16:20632081-20632103 GGATTTCAACATATGAATCTGGG + Intronic
1135273505 16:21089217-21089239 GGCTTTCAAGGTATGGTTCCAGG - Intronic
1135563964 16:23497616-23497638 GGATTTTAAGATACGGAACATGG - Intronic
1136488976 16:30592569-30592591 GGATTTCAAGACATGGATTTTGG + Intergenic
1136858091 16:33677420-33677442 GGCTTTCAGGATATGGATCTTGG + Intergenic
1137814942 16:51389605-51389627 GGGTTTCAACATATGAATGAGGG + Intergenic
1138090762 16:54172322-54172344 GGGTTTCAAGACAAGAATCCAGG - Intergenic
1138816854 16:60212509-60212531 AGGTTTCAACATATGGATTTTGG - Intergenic
1140650411 16:77082046-77082068 GGGTTTCAACATATGAATTTTGG + Intergenic
1140734003 16:77881684-77881706 GGGCTTTAAAATATGGGTCAAGG + Intronic
1140774408 16:78236880-78236902 GGGTTTCACCATATTGATCAAGG - Intronic
1203119658 16_KI270728v1_random:1525892-1525914 GGCTTTCAGGATATGGATCTTGG + Intergenic
1143715111 17:8762037-8762059 GGGTTTCAACATATGAATTTTGG - Intergenic
1143803468 17:9404936-9404958 GGGTTTCAAGATAGGGATCTTGG - Intronic
1143961821 17:10727591-10727613 GGAATTCAAGATACGGACCAGGG + Intronic
1145037394 17:19550967-19550989 GGGCTTCAACATACGGATCTAGG + Intronic
1145915728 17:28572977-28572999 GGGCTTCAAGTTATGGAGGAAGG - Intronic
1146681807 17:34813917-34813939 GGGTTTGAAGATATTTATGAAGG - Intergenic
1148268477 17:46244759-46244781 GGGTGTGAAGATAGGTATCAAGG + Intergenic
1149270469 17:54971572-54971594 GGGCTTCAACATATGGATTTTGG + Intronic
1149475826 17:56960329-56960351 GGGTTTCACCATATTGGTCAAGG - Intronic
1150074411 17:62180349-62180371 GGGTTTCACCATATTGGTCAGGG - Intergenic
1150645114 17:66973051-66973073 GGGTTTCACCATATTGGTCAGGG - Intronic
1150892353 17:69167551-69167573 GGGTTTCAAGACCTGGATCTTGG + Intronic
1150968965 17:70004899-70004921 GGGTTTCACCATATTGATCAGGG + Intergenic
1151643649 17:75414800-75414822 GGGCTTCAACATATGGATTTTGG - Intergenic
1151936900 17:77267514-77267536 GGGTTTCAACATGTTGGTCAGGG - Intergenic
1153409360 18:4776522-4776544 GGATTTCAACATATGGGTCTTGG + Intergenic
1153861618 18:9215828-9215850 AAGTTTCAAAATATGGATCTTGG + Intronic
1153968022 18:10199381-10199403 GGGTTTCAATATATGAATTTTGG + Intergenic
1154316346 18:13306854-13306876 GGATTTCAAGATATGGATCTTGG + Intronic
1155747875 18:29383442-29383464 GGGTTTCAACATATGAATTTCGG - Intergenic
1155759011 18:29540916-29540938 GAGTTTCAAGGTATGAATCTTGG + Intergenic
1155789400 18:29946604-29946626 GGGTTTCGATATATGGACCTTGG - Intergenic
1156038393 18:32792630-32792652 GGATTTCAAGATATGGATCTTGG - Intergenic
1156149885 18:34228459-34228481 GGATTTCAACATATGGATTGTGG - Intergenic
1156584784 18:38420191-38420213 AGGTTTCAAGATATGAATTTTGG - Intergenic
1156670181 18:39459261-39459283 GGGTTTCAATATATGCATTTGGG + Intergenic
1156851147 18:41727748-41727770 GGGTTTCAAGCTATGGATAGAGG - Intergenic
1157046659 18:44108214-44108236 GGGTTTCAAGATAGGGATCTTGG + Intergenic
1157093221 18:44660951-44660973 GGGTTTCAAGATAATGATGTTGG + Intergenic
1158358488 18:56646374-56646396 GGGTTTCAATATATGAATATTGG + Intronic
1158721032 18:59924902-59924924 GAGTTTCAACATATGAATCTGGG - Intergenic
1159067035 18:63581472-63581494 GGATTTCAAGATATGGATCTTGG + Intergenic
1159268204 18:66111750-66111772 GGATTTCAAGATATGAATCTTGG + Intergenic
1159534903 18:69703779-69703801 GGGTTTCAACATATGAATTTTGG - Intronic
1160346543 18:78137054-78137076 GGGTTTCAATATATGAATTTGGG - Intergenic
1160382460 18:78471067-78471089 AGGTTTCAACATATGGATTTCGG - Intergenic
1161093287 19:2374378-2374400 GGGTTTCACCATATTGGTCAGGG - Intergenic
1161380550 19:3962907-3962929 GGGTTTCACCATGTTGATCAAGG - Intronic
1162624139 19:11870407-11870429 GGGTTTCATCATATTGGTCAGGG - Intronic
1163225862 19:15960716-15960738 GGATTTCAACATATGGATTTTGG + Intergenic
1163682701 19:18692406-18692428 GGGTTTCATCATATTGATGACGG - Intronic
1163963837 19:20724734-20724756 GGGTTTCACCATGTGGGTCAGGG + Intronic
1164019884 19:21291670-21291692 GGGTTTCACCATATTGGTCAGGG - Exonic
1164893501 19:31846629-31846651 GGGTTCCAAGATACAGATCTTGG - Intergenic
1165580917 19:36862783-36862805 GGCTTTCAAGATATGAATTTTGG - Intronic
1165877672 19:39020786-39020808 GGGTTTCAAGCCATGGATCTTGG + Intronic
1166830289 19:45635329-45635351 GGGTTTCACCATATTGGTCAGGG + Intronic
1167132344 19:47595233-47595255 GGGTTTCATCATGTGGGTCAGGG + Intergenic
1167200566 19:48062305-48062327 GGGCTTCAACATATGAATCTGGG - Intronic
925550612 2:5069970-5069992 GGGTTTCAACATATGAATTTTGG + Intergenic
925651479 2:6094123-6094145 GGGTTTCAAGGTATGGATCTTGG - Intergenic
925794226 2:7525416-7525438 GGGTTACCAGATATGGTGCAGGG + Intergenic
926052811 2:9755600-9755622 GGGCTTCAACATATGGATTTTGG - Intergenic
926582578 2:14647496-14647518 GGATTTCAACATATGGATTTGGG - Intronic
926930547 2:18035085-18035107 GGATTTCAACATTTGGATTATGG + Intronic
927257861 2:21056024-21056046 GGGCTTCAATATATGGATTTTGG + Intergenic
927867709 2:26602062-26602084 GGGTTTCCAGAAATGCATAAAGG - Intronic
928538621 2:32263512-32263534 GGGCTTCAACATATGGATTTGGG - Intronic
928736098 2:34290911-34290933 GTGTATCAAGATATTGTTCAGGG + Intergenic
929141446 2:38670053-38670075 GGGTTTCACCATATTGGTCAGGG + Intronic
929161387 2:38835905-38835927 TGATTTCAAGATATGGATCTTGG + Intronic
929355821 2:41023047-41023069 GTGTTTCAAGATATGGATCTTGG + Intergenic
929396792 2:41532791-41532813 GGGTTTCAAGATATGAATTTTGG + Intergenic
929439869 2:41956858-41956880 GGGTTTCAACATATGAATTTCGG - Intergenic
929709636 2:44253515-44253537 GGGTTTCACCATATTGGTCATGG - Intergenic
929912678 2:46104262-46104284 GGGTTTCAAGATAGGGATCTTGG - Intronic
930013244 2:46953961-46953983 GGGTCTCAAGAGATGGAGCTTGG - Intronic
930717812 2:54609296-54609318 GGTTTTCATGATACGGATCTTGG - Intronic
930869736 2:56158348-56158370 GGGCTTCAACATATGGATTTGGG + Intergenic
930937977 2:56979876-56979898 GGGTTTCAAGATATGGATCTTGG + Intergenic
931010950 2:57912819-57912841 GGGTTTTAATATATGAATCTCGG - Intronic
931596422 2:63950080-63950102 GGATTTCAAGATAAGAATCTTGG - Intronic
931939778 2:67239457-67239479 GGGCTTCAACATATGGATTTTGG - Intergenic
932029298 2:68166907-68166929 GGGTTTCAAGATATGGATCACGG - Intronic
932071199 2:68622188-68622210 GGGTTTCAACATATGAATTTTGG - Intronic
932269086 2:70393260-70393282 AGGTTTCAACATATGGATTTTGG - Intergenic
932383905 2:71313114-71313136 GGGTTTCAAGACATGGATACTGG - Intronic
932808235 2:74801204-74801226 GGGCTGCAACATATGGATTAGGG - Intergenic
932989975 2:76775045-76775067 GGGTTTCAAGATATGTATCTTGG - Intronic
933018307 2:77160071-77160093 AGGTTTGAAGATATGCATCTTGG - Intronic
933485362 2:82915285-82915307 GAGTTTCAAGATATGGATCTCGG - Intergenic
933582761 2:84145971-84145993 GGGTTTCAATATATGAATTTTGG - Intergenic
933838436 2:86264834-86264856 GGGGTTCAAGCTTTGGAGCACGG + Intronic
934474040 2:94580943-94580965 GGGTTTAAGGATATGGGTGAAGG - Intergenic
934971649 2:98769154-98769176 GGGTTTCAACATTTGAATCTTGG + Intergenic
935337441 2:102029815-102029837 GGGTTTCAACATATGAATTTTGG + Intergenic
935445027 2:103147224-103147246 GAGTTTAAAGAAATAGATCAAGG + Intergenic
935473621 2:103490381-103490403 GGGTTTCAAGGTATGGATCTTGG + Intergenic
936103039 2:109600218-109600240 GGCTATTAAGATCTGGATCAGGG + Intronic
936659507 2:114526829-114526851 GGGTTTCAACATATAAATTAGGG + Intronic
937621797 2:123996990-123997012 GGGTTTCAAGATATGCATTTAGG - Intergenic
937765403 2:125655353-125655375 GGGTTTCACCATATTGGTCAGGG - Intergenic
937924354 2:127156445-127156467 GGGCTTCAACATATGGATCTGGG - Intergenic
939291911 2:140206785-140206807 GGATTTCAACATATGAATTATGG + Intergenic
940157618 2:150675929-150675951 GGATTTCAAGATATGAATCTTGG - Intergenic
940297435 2:152141781-152141803 GGGTTTCACCATATTGACCAGGG + Intronic
941144313 2:161824504-161824526 AGGTATCAGGATATGGATCTTGG + Intronic
941937908 2:171000982-171001004 GGGTTTCAAGATATGGATCTTGG - Intronic
942205126 2:173612422-173612444 GGGTTTCAGGATAAGGATTGGGG + Intergenic
942555761 2:177170977-177170999 GGGCTTCAAGATATGCATTTTGG - Intergenic
943129546 2:183839151-183839173 GGGTTTCTAGAGAGGGATCATGG + Intergenic
943195603 2:184744344-184744366 GGGTTTCAACATATGAATTTTGG - Intronic
943623021 2:190170269-190170291 GGGTTTCAACATATGAATTTGGG + Intronic
944174999 2:196819246-196819268 GGTTTTCAAGATATGAATTTGGG - Intergenic
944306077 2:198181331-198181353 GGGCTTCAACATATGAATTAGGG + Intronic
944381098 2:199111796-199111818 AGGTTTCAACATATGGATTTTGG - Intergenic
944930962 2:204518672-204518694 GGGTTTAAAGATAACGAGCAAGG + Intergenic
945492011 2:210466972-210466994 GGATTTCAAGATATGAATCTTGG + Intronic
946830795 2:223726386-223726408 GGGTTTCAATATATGAATTTGGG + Intergenic
946977743 2:225172561-225172583 GGATTTCAACATATGGATTTTGG - Intergenic
946996170 2:225394467-225394489 GGGTTTCAACATATGAATTTGGG - Intergenic
947313995 2:228835201-228835223 GGGTTTCAACATATGAATTTGGG - Intergenic
947891551 2:233626434-233626456 GTGTTTCAAAATATGAATCTTGG - Intronic
1169102553 20:2963735-2963757 GGATTTCAAAATTTGGATTAGGG + Intronic
1169292146 20:4361906-4361928 GGATTTCAACATATGAATTAGGG - Intergenic
1169296709 20:4406248-4406270 GGGTTTCAACATATGAATTTTGG + Intergenic
1170227734 20:14010765-14010787 GGGTTTCAAGATGCAGATCCTGG - Intronic
1170342511 20:15345194-15345216 GGGTTTCAACATATGAATTTTGG + Intronic
1170343733 20:15358926-15358948 GGGCTTCAAGATATGAATTTTGG + Intronic
1170602528 20:17851974-17851996 GGGTTTCAAGATATGGATTTTGG - Intergenic
1170791128 20:19510526-19510548 GGGCTTCAACATATGAATCTGGG - Intronic
1172678616 20:36694566-36694588 GGGTTTCAAGGTATGGATTTTGG - Intronic
1172899718 20:38325630-38325652 GGGTTTCAACATATGAATTTGGG + Intronic
1172950172 20:38718359-38718381 GGGCTTCAACATATGGATTTGGG + Intergenic
1173377182 20:42496603-42496625 GGATTTCAAGATACAGATCTTGG - Intronic
1174638967 20:52026640-52026662 GGGTTTCACCATATTGACCAGGG + Intergenic
1175066528 20:56293768-56293790 GGATTTCAACATATGGATTTTGG - Intergenic
1175728373 20:61334683-61334705 GGGTTTCAACATATGGATTTGGG + Intronic
1175968593 20:62672676-62672698 GGGCTTCAACATATGGCTCTGGG - Intronic
1176937661 21:14885183-14885205 GGGTTTCAACATATGAATTTTGG - Intergenic
1177063653 21:16402465-16402487 GGGGTTCAAGATATGAATCTTGG - Intergenic
1177240986 21:18456776-18456798 GAGTTTGAACATATGTATCAAGG - Intronic
1177503512 21:21990329-21990351 GGGTTTCAAGATATAGATCTTGG + Intergenic
1177729052 21:25004889-25004911 GGGTTTTAACATATGAGTCAGGG - Intergenic
1177734526 21:25072603-25072625 AGGTTTCAACATATGAATCTGGG + Intergenic
1177752879 21:25308030-25308052 GGGTTTCAACATATGAATTTTGG - Intergenic
1177806418 21:25879428-25879450 GGGTTTCAACATAGGGATTTGGG - Intergenic
1178818966 21:35957980-35958002 GAGTTTCAACATATGAATCTGGG + Intronic
1179013001 21:37570895-37570917 GGGTTTCAACATATGAATTCGGG - Intergenic
1179251608 21:39675394-39675416 GGACTTCAACATATGGATCTTGG + Intergenic
1180521340 22:16209162-16209184 GGGTTTCACCATATGGGCCAGGG - Intergenic
1182233255 22:28855067-28855089 GGGCTTCAACATATGAATCTTGG + Intergenic
1182253202 22:29018351-29018373 GGGTTTCTAGATTTGTATGATGG + Intronic
1182864945 22:33595967-33595989 GAGTTTCTAAATATGGAACAGGG + Intronic
1183179375 22:36248447-36248469 GTGTTCCAAGGTATGGATCCCGG + Intergenic
1183710377 22:39499915-39499937 GGGCTTCACCATATTGATCAGGG - Intronic
1183767418 22:39891810-39891832 GGGTTTCACCATATTGACCAGGG + Intronic
1184126042 22:42488041-42488063 GGGTTTCAACATGTTGACCAGGG - Intergenic
1184509388 22:44924419-44924441 GGATTTCAACATTTGGATCTGGG - Intronic
1185212495 22:49578065-49578087 GGGGTGCAAGGTATGGATCCAGG + Intronic
1185212593 22:49579326-49579348 GGGTTTCAATATGTGGATTTTGG - Intronic
1185356212 22:50372879-50372901 GGGTTTCACCATATTGACCAGGG + Intronic
949264500 3:2140654-2140676 GGATTTCAAGATATGAATTTTGG + Intronic
949830076 3:8204886-8204908 GAGTTTGAAGTTATGGATAAGGG - Intergenic
949846894 3:8380733-8380755 GGGTTTCAACATATGAATTTGGG - Intergenic
949922874 3:9017061-9017083 TTGATTCAAGATCTGGATCAAGG - Intronic
950120407 3:10478693-10478715 GGGTTTCAAGAAATGTAGGAAGG - Intronic
951244490 3:20324741-20324763 TGGTTTCAGGATATGGCTGAGGG - Intergenic
951430467 3:22601199-22601221 AGGTTTCAATATATGGATTTTGG - Intergenic
951875046 3:27414807-27414829 GGGTTTCAAGATGTGGATCTTGG - Intronic
951949975 3:28189183-28189205 GGATTTCAAAATATGGATCTTGG + Intergenic
952329014 3:32346727-32346749 GGGGTTCAACATATGGATTTGGG + Intronic
952643294 3:35624558-35624580 GGATTTCAATATATAGATCTTGG + Intergenic
953083864 3:39647782-39647804 GCCTTTCAAGATCTGGAGCAGGG - Intergenic
953204129 3:40806165-40806187 GGGTTTCAAGATATGGATTTTGG + Intergenic
953279270 3:41537156-41537178 GGGTTTCAAGATACGAATCGTGG - Intronic
953719794 3:45345413-45345435 GGGCTTCAACATATGGATTTGGG + Intergenic
953778799 3:45847151-45847173 GGGTTTCAAGGTGTGAATCTTGG - Intronic
954001539 3:47561220-47561242 GGGCTTCAACATATGGATTTTGG - Intergenic
954104212 3:48400529-48400551 GGGTTTCACCATGTTGATCAGGG + Intronic
954203915 3:49043301-49043323 GGGTTTCATCATATTGGTCATGG - Intronic
954884729 3:53862552-53862574 GGGTTTCAAGATACGGATCTTGG + Intronic
955382589 3:58451894-58451916 GGGTTTCAAGATATGGATCTTGG - Intergenic
955867408 3:63399633-63399655 AGGTTTCAATATATGAATCTGGG + Intronic
956228481 3:66986480-66986502 GGGTTTCAACATATGAATTTGGG + Intergenic
956394125 3:68806608-68806630 GGGTTTCAACATATGAATTGTGG - Intronic
956572197 3:70709383-70709405 TGGTTTCAAGGTATAGATCTTGG - Intergenic
956672111 3:71700843-71700865 GGGTTTCAGCATATGAATCTGGG - Intronic
957183812 3:76916074-76916096 GGGTTTCAATATATGAATTTGGG + Intronic
957444338 3:80295403-80295425 GGGTTTCAAGATATAGATACTGG + Intergenic
957973718 3:87416737-87416759 GGGCTTCAACATATGGATTCTGG - Intergenic
957979965 3:87496026-87496048 GGGTTTAAAGATATGGATCTTGG - Intergenic
958661109 3:97068669-97068691 GGGTTTCAACATATGAATTGTGG - Intronic
958950632 3:100411853-100411875 GGGCTTCAACATATGGATTTTGG + Intronic
959146889 3:102557324-102557346 GGGTTTTAAGACATGAATCTTGG + Intergenic
959321835 3:104886588-104886610 GGGTTTCAACATATGAATTTCGG - Intergenic
959340133 3:105118444-105118466 GGGTTTCACCATATTGGTCAGGG + Intergenic
959412004 3:106036025-106036047 GGGTTTCAACATATGAATGGGGG + Intergenic
959601077 3:108186353-108186375 AGGTTTCAAAATATGGATTTTGG + Intronic
960237998 3:115306991-115307013 GGGCTTCAAGATATGGATTTTGG - Intergenic
960536845 3:118824438-118824460 GGGTTTCACCATATTGGTCAGGG + Intergenic
960799696 3:121525859-121525881 GGGTTTCAAGATATGAATCTTGG - Intronic
961575033 3:127828315-127828337 GAGTTTCACTATATTGATCAGGG + Intergenic
962783552 3:138744907-138744929 GGGTTTCAAGATACAGATCGTGG - Intronic
963241655 3:143009155-143009177 GCATTTCAAGATATGTTTCAGGG + Intronic
964033961 3:152172787-152172809 GGGTTTCAAGATTTGGATCTTGG + Intergenic
964307465 3:155356632-155356654 GGGTTTCAACATATGAATTTGGG - Intergenic
964312409 3:155408744-155408766 GGGCTTCAAGATATGAATTTGGG + Intronic
964453915 3:156839564-156839586 GGGTTTCAAGATACTAATCTTGG + Intronic
964807555 3:160628071-160628093 GGGTTTCAACATATGAATTTGGG + Intergenic
964913046 3:161805070-161805092 GCGTTTCAACATATGGATTTGGG + Intergenic
965037412 3:163458739-163458761 GGGTTTCAACATATGAATTTGGG - Intergenic
965061608 3:163791078-163791100 GGGTCTCAAGATAAGAATCTTGG - Intergenic
965347264 3:167567351-167567373 GGGTTTCAAGATATGAATTTTGG - Intronic
965431730 3:168597263-168597285 GGATTTCAACATATGAATCTGGG - Intergenic
965631780 3:170740655-170740677 GGATTTCAATATATGGATTTGGG + Intronic
967045954 3:185736729-185736751 GGGTTTCAAGTTAGGCTTCACGG + Intronic
967078622 3:186028014-186028036 GGGTTTCAAGATGTGAATTGGGG - Intergenic
967205410 3:187115529-187115551 ATGGTACAAGATATGGATCAAGG + Intergenic
967854501 3:194106540-194106562 GGGTTTCAACATATGAATTTAGG + Intergenic
967911756 3:194548249-194548271 GGGTTTCACCATGTTGATCAGGG + Intergenic
968147561 3:196312208-196312230 GGGTTTCACCATATTGTTCAGGG + Intronic
968333959 3:197896810-197896832 GGATTTCAACATATGGATTTGGG + Intronic
970000523 4:11361052-11361074 GGGTTTCACTATATGGATCTTGG + Intergenic
970260921 4:14223967-14223989 GGGTTTCAACATATGAATTTGGG - Intergenic
970314691 4:14817879-14817901 GGGTTTCAACATATGGATTTTGG + Intergenic
970350949 4:15201318-15201340 GGGTCTTATGATATGGAACAGGG + Intergenic
970568135 4:17352474-17352496 GGGATTCAACATACGGATCTGGG - Intergenic
970778826 4:19710643-19710665 AGGTTTCAACATATGGATTTGGG - Intergenic
970927594 4:21470947-21470969 GGGTCTCAAAATATGGCTCTTGG + Intronic
970988910 4:22190728-22190750 GGGCTTCAATATATGAATCTGGG + Intergenic
971159609 4:24120609-24120631 GGGTTTCAACATATGAATTTTGG - Intergenic
971362835 4:25952909-25952931 GGGCTTCAACATATGGATTTTGG - Intergenic
971375080 4:26049933-26049955 TGGGTTCAAGATATGGAGGATGG + Intergenic
971420753 4:26472028-26472050 GGGTTTCAACATATGAATTTGGG - Intergenic
971547566 4:27905842-27905864 GGATTTCAAGATATGAATTTTGG + Intergenic
971805376 4:31351685-31351707 GAGTTTCAACATATGGATTTGGG - Intergenic
971862850 4:32130577-32130599 AAGTTTCAAGATATGAATCTTGG - Intergenic
972351632 4:38241795-38241817 GGGTTTCACCATGTTGATCAGGG - Intergenic
972790110 4:42363733-42363755 GGGTTTCAACATATGAATTTGGG - Intergenic
972876088 4:43362107-43362129 GGGTTTCACCATATTGGTCAGGG + Intergenic
972989372 4:44804684-44804706 GGGTTTCAATATATGAATTTTGG - Intergenic
974321077 4:60350859-60350881 GGGTTTCCAGATGTGGTCCAGGG + Intergenic
974815234 4:66995542-66995564 GGGCTTCAACATATGAATGATGG + Intergenic
974970730 4:68823311-68823333 GGGTTTCACCATATCGTTCAGGG - Intronic
974985060 4:69013096-69013118 GGGTTTCACCATATCGTTCAGGG + Intronic
975257359 4:72254085-72254107 AGGTTACAAAATATGGATCCTGG + Intergenic
976245318 4:83001248-83001270 GGGTTTCAAGATATGCATCTTGG + Intronic
976426801 4:84913461-84913483 GGGTTTCAAAATATGGATCTTGG + Intronic
976683707 4:87786903-87786925 GGGTTTCAACATATGGATTTTGG - Intergenic
977099757 4:92795873-92795895 GGGTTTCAACATAGGGATCTTGG - Intronic
977242829 4:94593690-94593712 GGGCTTCAACATATGAATAATGG + Intronic
977314521 4:95428929-95428951 GGGTTTCCAGTTAAGGATCTGGG - Intronic
977317471 4:95468423-95468445 GCATTTCAAGATATAGATCTTGG - Intronic
977727602 4:100315014-100315036 GGGTTTCAACATGTTGGTCAGGG + Intergenic
977751629 4:100616644-100616666 GGGTTTCAACATATGAATTTGGG + Intronic
978063993 4:104373342-104373364 GGGTTTCACCATGTTGATCAGGG + Intergenic
978502920 4:109428257-109428279 GGGCTTCAACATATGGATTTTGG - Intergenic
978595441 4:110372754-110372776 GGGTTTCAACATATGAATTGTGG + Intronic
979016112 4:115435812-115435834 GGGTTTCAGGATATGGATCTTGG + Intergenic
979350003 4:119632539-119632561 GGGCTTCAACATATGAATCTGGG - Intergenic
979704294 4:123703251-123703273 GGGTTTCAACATATGGTTTGAGG - Intergenic
980609176 4:135135282-135135304 GGGTTTCAACATACGGATTTGGG - Intergenic
980790715 4:137616130-137616152 GGGCTTCAAGATATGAATGGTGG - Intergenic
980838197 4:138223897-138223919 GTTTTTCAAGATATGTTTCAGGG + Intronic
980986149 4:139696582-139696604 GGGTCTCAAGATATGAATCTTGG - Intronic
981056269 4:140365200-140365222 GGGTTTCAAGATCTGGATCTTGG + Intronic
981170456 4:141616665-141616687 GGGTTTCAAGATATGGATCTTGG - Intergenic
981175373 4:141676800-141676822 GGATTTCAGGATATGGATCTTGG + Intronic
981198839 4:141953806-141953828 AGGTTTCAAGATACCGATCTTGG - Intergenic
981571687 4:146158354-146158376 GGATTTCAAGAAATGGATCTTGG + Intergenic
981571742 4:146158951-146158973 GGGTTTCAAGATAAGGATCTTGG - Intergenic
982113436 4:152076952-152076974 GGATTTCAATATATGAATCTGGG - Intergenic
982344884 4:154346169-154346191 GGGTTTCAACATATGAATTTTGG + Intronic
982514932 4:156333839-156333861 AGGTTTCAATATATGAATCTGGG + Intergenic
983248781 4:165320843-165320865 GGGTTTCAAGGTATGGATCTTGG + Intronic
983525488 4:168756499-168756521 AGGTTTCAAGACATGAATGATGG + Intronic
984375781 4:178927070-178927092 AAGTTTCAAGATATGAATCATGG - Intergenic
984419900 4:179507577-179507599 GGGTTTCAAGATATGGATCATGG - Intergenic
984729508 4:183054429-183054451 GGGTTGCAAGATATGCATCTTGG + Intergenic
984927690 4:184820795-184820817 GGGTTTCACCATATTGGTCAGGG + Intronic
986340277 5:6783386-6783408 GGTTTTAAAGATATTGATCTTGG + Intergenic
986502228 5:8413030-8413052 GAGATTCAAGACATGGATCATGG - Intergenic
986509281 5:8486383-8486405 GGGTTTCAAGATATGGGTCTTGG + Intergenic
986573316 5:9188031-9188053 GGGCTTCAACATATGAATCCTGG - Intronic
987365063 5:17141288-17141310 GGGTTTCAACATATGAATTGGGG - Intronic
987905984 5:24077952-24077974 GGGCTTCAACATATGGATTTGGG - Intronic
988414967 5:30934826-30934848 GGGTTTCAAGATACTGATTAAGG - Intergenic
988515365 5:31899660-31899682 GGATTTCAACATATGAATTAGGG - Intronic
988695541 5:33618694-33618716 GGGTTTCAAGATATGGATTTTGG - Intronic
988801421 5:34699640-34699662 GGGCTTCAACATATGGATTTTGG + Intronic
988880166 5:35493970-35493992 GGGTTTCAAGATATGGATATTGG - Intergenic
988895929 5:35674774-35674796 GGGCTTCAACATATGAATCTGGG + Intronic
989308516 5:39985481-39985503 GCATTTCAAGATATGCATCTTGG + Intergenic
990911243 5:60854614-60854636 AGGTTTCAACATATGGATTTAGG + Intergenic
991250923 5:64560243-64560265 GGTTTTCAAGGTATGGTTCCTGG + Intronic
991650958 5:68852780-68852802 GGGTTTCAAGATAGAGATCTTGG + Intergenic
992001182 5:72437999-72438021 TGGTTTCAAGATATGAATTTTGG + Intergenic
992110600 5:73488957-73488979 GGGTTTCAACATATGAATTTCGG + Intergenic
992646940 5:78819929-78819951 GGGTTCCAACATATGGATTTTGG - Intronic
993574425 5:89583911-89583933 GGGCTTCAATATTTGGATCTGGG + Intergenic
993638592 5:90375208-90375230 GGGTTTTAAGATAGGAATCTTGG - Intergenic
993756028 5:91731586-91731608 GGGTTTCAACATATGAATTTTGG - Intergenic
993850949 5:93008502-93008524 AGGTTTCAAGATATGAATTTTGG - Intergenic
993929610 5:93922309-93922331 GGGTTTCAAGATAAGGATCTTGG + Intronic
994117571 5:96078235-96078257 GGGTTTCAACATATGAATTTTGG + Intergenic
994442478 5:99827550-99827572 GGGTTTCAAGATACAGATTTTGG + Intergenic
994494886 5:100499412-100499434 GGGTTTCACCATATTGACCAGGG - Intergenic
994569968 5:101503610-101503632 GGTTTTCAACATATGGAACTTGG + Intergenic
994607608 5:101989231-101989253 GGATTTCAAGATACAGATCCTGG - Intergenic
994856655 5:105130307-105130329 GGGTTTTAAGATATGGATTTTGG + Intergenic
995683788 5:114748906-114748928 GGGTTTCAACATATGAATTTTGG - Intergenic
995830598 5:116350818-116350840 GGATTTCAAGATAAGAATCTTGG - Intronic
996086753 5:119312705-119312727 GGGTTTCACCATATTGCTCAGGG - Intronic
996509147 5:124299503-124299525 GGGCTTCAATATATGAATGAGGG + Intergenic
996614872 5:125429232-125429254 GGGTTTCAGGCTATGGATCTTGG + Intergenic
997395770 5:133558657-133558679 GGGTTCCAAGAAATGCGTCAGGG - Intronic
997619769 5:135279158-135279180 GGGCTTCAACATATGGATATTGG + Intronic
999066046 5:148686589-148686611 GGATTTCAACATATGAATTAGGG - Intergenic
999412222 5:151360906-151360928 GGGTTTCAAGATATGGATCTTGG - Intergenic
999865319 5:155694737-155694759 GGTTTTTAAAATATGAATCAAGG + Intergenic
1000013865 5:157260076-157260098 GCGTCTCAACATATGGATCTTGG - Intergenic
1001186650 5:169580328-169580350 GGGTTTCAACATATGAATATGGG + Intergenic
1001344916 5:170885833-170885855 GGGTTTCAAGATATGGATCTTGG - Intronic
1003243187 6:4362009-4362031 GGGTTTCAACATATGCATTTCGG + Intergenic
1003552843 6:7114312-7114334 GGGTTTCACCATGTTGATCAGGG + Intronic
1003690599 6:8350013-8350035 GGGTTTCAATATATGAATTTTGG + Intergenic
1003718439 6:8673646-8673668 GGGCTTCAACATATGAATCTGGG - Intergenic
1004446646 6:15706179-15706201 GTGTTTCAAGATACAGATCTTGG + Intergenic
1004486693 6:16072979-16073001 GGGTTTCAACATATAAATCTGGG + Intergenic
1004604260 6:17179077-17179099 GGGCTTCAACATATGGATTTTGG - Intergenic
1004840641 6:19580163-19580185 GGGTTTCAAGATATGGATCTTGG + Intergenic
1005023549 6:21440987-21441009 GGGTTTCAACATATGGATTCTGG - Intergenic
1005190522 6:23216567-23216589 GGGCTTCAACATATGGATTTGGG + Intergenic
1005945595 6:30593102-30593124 GGGTTTCAATATGTTGGTCAGGG - Intronic
1006659470 6:35627962-35627984 GGGTTTCACCATATTGGTCAGGG + Intronic
1006826280 6:36938601-36938623 GGGTTTCAACATATGAATTATGG + Intergenic
1007305873 6:40904155-40904177 GGATTTCAACATATGAATCTGGG - Intergenic
1007318511 6:41009353-41009375 GGGTTTCAACATTTGGATTTTGG + Intergenic
1007732813 6:43959435-43959457 GGATTTCAAGATATGGATCTTGG + Intergenic
1008855902 6:56087026-56087048 GGGTCCCAAGATATGGATCGTGG - Intronic
1009859104 6:69302926-69302948 GAATTTCAAGATATGGATCTTGG + Intronic
1010557050 6:77295262-77295284 GTGTTTCAAGATATCCTTCAAGG + Intergenic
1010728199 6:79359670-79359692 GGGTTTCTAGATACAGATCTTGG - Intergenic
1010807699 6:80258533-80258555 GGGATTAAAGGTAAGGATCAGGG + Intronic
1010828603 6:80503137-80503159 GAGTTTCAAGATATGAATCTTGG + Intergenic
1011080863 6:83489199-83489221 GGGTTTCACCATATTGGTCAGGG - Intergenic
1011130220 6:84044767-84044789 GGGCTTCAACATATGGATGTTGG + Intronic
1011599679 6:89048461-89048483 GGGAATGAAGATAAGGATCAAGG - Intergenic
1012030975 6:94062833-94062855 GGGCTTCAACATATGAATTATGG - Intergenic
1013035258 6:106376324-106376346 GAGGTTCAAGATGTGGATAAAGG - Intergenic
1013363355 6:109415491-109415513 CGTTGTCAAGATATGGATCTTGG - Intronic
1013632076 6:111995656-111995678 AGGTTTCAACATATGAATCTGGG + Intergenic
1013692015 6:112657063-112657085 GGGTTTCAACATATGAATTTGGG - Intergenic
1014061489 6:117077079-117077101 GGGTTTCAGGATATGAATCTTGG + Intergenic
1014114228 6:117654361-117654383 GGGCTTCAACATATGGATTTTGG + Intergenic
1014511063 6:122323046-122323068 GGGTTTTAAGATATGAATCTTGG - Intergenic
1014993297 6:128109000-128109022 GGGCTTCAACATATGGATTTTGG + Intronic
1015340137 6:132089777-132089799 GGGCTTCAACATATGGATTTGGG - Intergenic
1016180742 6:141145144-141145166 GGGTTTTAAGATATGGATCTTGG + Intergenic
1016860239 6:148710546-148710568 GGGATTCAACATATGGATTTTGG + Intergenic
1016950413 6:149574241-149574263 GGGTTTCACCATATTGGTCAAGG + Intronic
1016964714 6:149708220-149708242 GGGTTTCACCATATTGACCAGGG - Intronic
1017051746 6:150399913-150399935 GGGTTTCAACATATGAATTGCGG + Exonic
1017056487 6:150441081-150441103 GGGTGTCAAGATACGGTTCTTGG + Intergenic
1017122657 6:151039024-151039046 GGGTTTAAGGATATGGGTGAAGG + Intronic
1017473697 6:154766617-154766639 GGGTTTCAGGATATGAATCTTGG - Intronic
1017607700 6:156151019-156151041 AGGTTTCAATATATGAATCCAGG + Intergenic
1018040572 6:159918315-159918337 GGATTTCAACATATGAATCTGGG - Intergenic
1018094865 6:160376416-160376438 GGGTCTTAAAATATAGATCATGG + Intronic
1018197221 6:161366028-161366050 GGATTTCAACATATCGATCCGGG - Intronic
1018832220 6:167451901-167451923 GGGCTTCAACATATGGATTTGGG + Intergenic
1019030554 6:169006772-169006794 TGGTTACAGAATATGGATCATGG - Intergenic
1019096569 6:169586169-169586191 TGGTTTCAAGCTATGGATCTTGG - Intronic
1019124111 6:169827861-169827883 GGGCTTCAATATAAGGATCAGGG - Intergenic
1021344427 7:19507261-19507283 GGTTTTAAAGATACGTATCAGGG + Intergenic
1021537451 7:21721740-21721762 GGGCTTCAAAATATGGATTTGGG + Intronic
1021694994 7:23267765-23267787 GGGTTTCAACATATGAATTTCGG + Intronic
1021887657 7:25155973-25155995 GGATTTCAATATATGGATGAGGG - Intronic
1022022247 7:26412053-26412075 GGGCTTCAACATATGGATTTTGG - Intergenic
1022120263 7:27301564-27301586 GGGCTTCAACATATGAATCTTGG - Intergenic
1022145913 7:27540400-27540422 GGCTTTCAAGATATGGATCTTGG - Intronic
1022891213 7:34701822-34701844 TGTTTTCAAGATGTGGGTCATGG - Intronic
1023184588 7:37519773-37519795 GGGTTTCAACATATGAATTGTGG - Intergenic
1023215186 7:37854778-37854800 AGGTTTCAAGATATGGATGTTGG - Intronic
1023280641 7:38565660-38565682 GGGTTTCAACATATGAATTTGGG + Intronic
1023305470 7:38821514-38821536 GGGTTTCACCATATTGGTCAGGG - Intronic
1023746101 7:43323840-43323862 GGGTTTCACCATATGGGCCAGGG - Intronic
1023769781 7:43546184-43546206 GGGTTTCAAGATATAGATCTTGG - Intronic
1024141843 7:46469697-46469719 GGGTTTCACCATGTGGCTCAGGG - Intergenic
1024214461 7:47235627-47235649 GGGCTTCAAGATATGAATTAGGG + Intergenic
1024256609 7:47544378-47544400 GGATTTCAACATATGGATTTTGG - Intronic
1024632544 7:51261773-51261795 GGGTTTCACGATGTTGGTCAAGG - Intronic
1026260185 7:68748190-68748212 GGGTTTCAACATATTAGTCAGGG - Intergenic
1026276707 7:68885150-68885172 GGGATTCAACATATGGATTTTGG + Intergenic
1026308188 7:69160725-69160747 GGATTTCAACATATGGATTTGGG - Intergenic
1027788902 7:82614637-82614659 GGGTTTCAAAATATGAATTTTGG + Intergenic
1028058326 7:86276837-86276859 GGGTTTCAAGATACGGATCTTGG + Intergenic
1028152960 7:87396125-87396147 GGATTTCAAGGTATGGATGTTGG + Intronic
1028307677 7:89286555-89286577 GGTTTTCAAGATATCGATCCTGG + Intronic
1029054026 7:97721235-97721257 GGGTTTCAACATATGAATTTTGG + Intergenic
1029187025 7:98746698-98746720 GAATTTCAACATATGGATCTAGG + Intergenic
1029496645 7:100898603-100898625 GTGTTAGAAGATGTGGATCAAGG - Intergenic
1029543247 7:101196968-101196990 GGGTTTCACCATATTGGTCAGGG - Intronic
1030131333 7:106204133-106204155 CGGTTTCAAGATATGGATCCTGG - Intergenic
1030203471 7:106929196-106929218 GGGTTTCAAAATATGAATTTTGG + Intergenic
1030303583 7:107998441-107998463 GGGTCTCATGATAAGGATCTTGG + Exonic
1030362338 7:108608104-108608126 GGGTTTCAATATATGAATTTTGG - Intergenic
1030866224 7:114704551-114704573 GGATTTCAACATATGGATTTAGG + Intergenic
1030870142 7:114745830-114745852 GGGTTTCACCATGTGGACCAGGG + Intergenic
1031033192 7:116757296-116757318 GAGTTTCAAGATAAGCATTAAGG - Intronic
1031060724 7:117048564-117048586 GGGTTTCAAGATATGGATCTTGG - Intronic
1031379977 7:121073771-121073793 GGGTTTCAAGATATGGATCTTGG - Intronic
1031581823 7:123485435-123485457 GGATTTCAACATATGGATTTGGG + Intronic
1031656234 7:124359726-124359748 GGGTTTCAACATATGAATTTGGG + Intergenic
1031684926 7:124721486-124721508 GGGTTTCAATGTATGGATTTTGG + Intergenic
1031889606 7:127278747-127278769 GGGTTTCAAGATACGAATCTTGG + Intergenic
1032628091 7:133614832-133614854 GGGTTTCAAGATAGAGATCTTGG + Intronic
1033121770 7:138672858-138672880 GGATTGCAAAATATGGATAAAGG - Intronic
1034001468 7:147417508-147417530 GGGTTTCAATATATGAATTTTGG + Intronic
1034133249 7:148740635-148740657 GGGCTTCAAGATATGAATGGAGG - Intronic
1034821625 7:154221464-154221486 AGGTTTCAATATATGAATCTGGG + Intronic
1034876458 7:154728963-154728985 GGGTTTCAATATATGAATTTGGG + Intronic
1034986229 7:155517094-155517116 GGGCTTCAACATATGGATTTTGG - Intronic
1035061406 7:156072129-156072151 GGGTTTCAACATAGGAATCCTGG - Intergenic
1036487556 8:9193471-9193493 GGGTTTCAACATATTAATGAGGG - Intergenic
1036503494 8:9334800-9334822 GGGTTTCAACATATGAATTTTGG - Intergenic
1037006103 8:13782358-13782380 GGGTTTGGAAATATGGATCTGGG - Intergenic
1037013432 8:13873770-13873792 GTCTTTCAAGATATGGATCTTGG - Intergenic
1038358016 8:26848296-26848318 GGGTTTCAACATGTGGATTTGGG - Intronic
1038591509 8:28842633-28842655 ACGTTTCAAGATATGGAGCTTGG - Intronic
1038849808 8:31264798-31264820 GGGTTTCAATGTATGGATTTTGG + Intergenic
1039019890 8:33193670-33193692 GGATGTGAAGATATGGCTCATGG - Intergenic
1039217913 8:35293558-35293580 GGGTTTCAAGATATGATCCTTGG - Intronic
1039335147 8:36581013-36581035 GCTTTTCAAGATGTGGACCATGG + Intergenic
1039460931 8:37743566-37743588 GGGCTTCAACATATGAATCTGGG + Intronic
1040049271 8:42996191-42996213 GGGTTTCACTATGTTGATCAGGG - Intronic
1041353455 8:56973583-56973605 GGGTTTCAAGATAGGGATCTTGG + Intronic
1041599004 8:59693586-59693608 GGGTTTCAACATATGAATTTGGG - Intergenic
1041614923 8:59895175-59895197 GGGTTTGAAGATACAGATCTCGG + Intergenic
1041685071 8:60636523-60636545 GGGTTTCAACATATGAATTTGGG + Intergenic
1041850227 8:62382781-62382803 GGGTTTCAAAATATAGATATCGG - Intronic
1041857805 8:62478110-62478132 GGGTTTCAACATATGCATTTTGG + Intronic
1042027595 8:64440444-64440466 AGGTCTCCAGATATGGAACAAGG + Intergenic
1042057574 8:64782246-64782268 AGGTTTCAACATATGAATCTTGG - Intronic
1043132946 8:76484223-76484245 GGGTTTCAACATATGAATTGTGG + Intergenic
1043539988 8:81250752-81250774 AGGTTTCAGGATATGGATCTTGG + Intergenic
1043710644 8:83413287-83413309 GGGTTTCTTGATCTGGATCCTGG + Intergenic
1044059303 8:87614920-87614942 GGGTTTCAACATATGAATTTTGG - Intronic
1044642625 8:94400054-94400076 GGGTTTCAACATATGAATCTGGG + Intronic
1044762058 8:95530449-95530471 GGGTTTCAAGATACAGGTCTTGG - Intergenic
1044874748 8:96654223-96654245 AGGTGTCAAGATATGAATCTTGG - Intronic
1044929861 8:97241564-97241586 GGGTTTCAATATATGAATTTTGG + Intergenic
1045218581 8:100174815-100174837 GTGTTTCAAGATATGGAAGTTGG - Intronic
1045399273 8:101795637-101795659 GGGTTTCAACATATGAATTTGGG + Intronic
1045420955 8:102014432-102014454 GGGTTTCAACATATGAATTCTGG + Intronic
1045981750 8:108197656-108197678 GGGTTTCAAGATACAGATCTTGG + Intergenic
1046227018 8:111295613-111295635 AGGTTTCAAGATATGGATCTTGG - Intergenic
1046254582 8:111679741-111679763 GGGTTTCAATATATGAATTTTGG + Intergenic
1046446348 8:114325576-114325598 GGGTTTCAAGTTATGGATCTTGG - Intergenic
1047170224 8:122485461-122485483 GGGTTTCAGCATATGGATTCAGG + Intergenic
1047867987 8:129049907-129049929 GGGTTTAAAGATATAAATCTTGG + Intergenic
1048438741 8:134443531-134443553 GGGTTTCGGGATATGGATCTTGG + Intergenic
1048496847 8:134942518-134942540 GGGTCTCTAGATATGGCTCCAGG + Intergenic
1048528029 8:135222225-135222247 GGGCTTCAACATATGAATCTGGG - Intergenic
1048770326 8:137888094-137888116 GGGTTTGAAGATGTGGAGCTGGG - Intergenic
1048932394 8:139325465-139325487 GGGGTTCAAGATGTGTATCAGGG - Intergenic
1049036647 8:140081536-140081558 GGGTTTCACCATATTGACCAGGG + Intronic
1050224204 9:3432608-3432630 AGGTTTGAAGACATGGATCTTGG + Intronic
1050474941 9:6031378-6031400 GGGTTGGAAGATATGGAACCAGG - Intergenic
1050696382 9:8283772-8283794 GGGTTTCAACATATGAATTTGGG + Intergenic
1050844649 9:10199539-10199561 GTGTTTCAAGAAATGGGTGAGGG + Intronic
1050856692 9:10366232-10366254 GGGTTTCCAGAAAGAGATCATGG - Intronic
1050916782 9:11145893-11145915 GGGTTTCAACATATGCATTTTGG - Intergenic
1050996165 9:12219941-12219963 GATTTTCCAGATATGAATCAGGG + Intergenic
1051821269 9:21172259-21172281 GGGTTTCAACATATGAATTTTGG - Intergenic
1052431544 9:28373597-28373619 GGGATTTAAGATATGGATTCAGG + Intronic
1052616092 9:30843750-30843772 GGGTTTCAACATATGAATTCGGG + Intergenic
1053392194 9:37743994-37744016 GGGTTTCACCATATTGGTCAGGG - Intronic
1053558663 9:39165244-39165266 GGATTTCAACATATGAATCTGGG + Intronic
1053684036 9:40505189-40505211 GGGTTTAAGGATATGGGTGAAGG + Intergenic
1053822789 9:41985476-41985498 GGATTTCAACATATGAATCTGGG + Intronic
1053934010 9:43133474-43133496 GGGTTTAAGGATATGGGTGAAGG + Intergenic
1054138448 9:61453697-61453719 GGATTTCAACATATGAATCTGGG - Intergenic
1054279685 9:63119764-63119786 GGGTTTAAGGATATGGGTGAAGG - Intergenic
1054297131 9:63340653-63340675 GGGTTTAAGGATATGGGTGAAGG + Intergenic
1054395151 9:64645161-64645183 GGGTTTAAGGATATGGGTGAAGG + Intergenic
1054429798 9:65150361-65150383 GGGTTTAAGGATATGGGTGAAGG + Intergenic
1054500585 9:65871171-65871193 GGGTTTAAGGATATGGGTGAAGG - Intergenic
1054607786 9:67201889-67201911 GGATTTCAACATATGAATCTGGG - Intergenic
1054959867 9:70956134-70956156 GTGTTTCAGGATAAGGATTAAGG + Intronic
1055087235 9:72326585-72326607 GGGTTTCACCATATTGGTCAAGG - Intergenic
1055182525 9:73405436-73405458 GGGTTTCAACATATGAATTTTGG - Intergenic
1056217470 9:84418705-84418727 GGGTTTCAACATATGCATTTTGG - Intergenic
1056389630 9:86129032-86129054 GGGTTTCAACATATGCATTTTGG - Intergenic
1056625437 9:88249310-88249332 GGGTTTCAACATATGAATTTGGG - Intergenic
1056782175 9:89558907-89558929 GGGTTTCAACATATGGTTTGGGG + Intergenic
1056844772 9:90027728-90027750 GGGTTTCAATATATGGATTTTGG + Intergenic
1056886330 9:90447443-90447465 GGGTTTCTAGAGATGAGTCAAGG + Intergenic
1057536989 9:95919808-95919830 GGGTTTCAAGAGACGGATCTTGG + Intronic
1057742253 9:97722040-97722062 GGGTTACAAGGTAAGAATCAGGG + Intergenic
1057815937 9:98294668-98294690 GGGTTTCACCATATTGGTCAGGG + Intronic
1058054495 9:100435858-100435880 GGGCTTCAACATATGGATCTTGG + Intronic
1058166053 9:101620394-101620416 AGGTTTCAACATATGAATCTGGG + Intronic
1058560316 9:106221635-106221657 GGATTTCAACATATGAATCGGGG - Intergenic
1058578727 9:106431566-106431588 GGGATTCTAGATTTGAATCAGGG + Intergenic
1058704195 9:107625192-107625214 GGGTTTCACCATGTTGATCAGGG + Intergenic
1058837434 9:108870936-108870958 GGATTTCAAGATAGGAATCTTGG - Intronic
1058862434 9:109129024-109129046 GGGTTTCAACATATGAATTTGGG + Intergenic
1058982894 9:110186637-110186659 GGGTTTCAAGAGAGTGAGCAGGG + Intergenic
1060351447 9:122864573-122864595 GGCTTTCAAGTTCTGGCTCATGG - Intronic
1060610984 9:124964310-124964332 GGGTTTCGAGATACAGATCTTGG - Intronic
1061644622 9:131990683-131990705 GGTTTTCAGGATGTGGAGCATGG - Intronic
1062088315 9:134660095-134660117 TGGTTTAAAGATGTGGATCGTGG - Intronic
1185731706 X:2466871-2466893 GGGTTTCAGCATGTTGATCAGGG - Intronic
1185732477 X:2472575-2472597 GGGTTTCACCATATTGGTCAGGG - Intronic
1186208173 X:7221903-7221925 GGGTTTCAACATATGAATTTTGG - Intronic
1186851732 X:13586648-13586670 GGGTTTCAATATATGAATTTTGG + Intronic
1187365216 X:18661119-18661141 GGGTTTCAACATATGAATTTTGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187961935 X:24574731-24574753 GTGTTACAAGACATGGATCATGG - Intronic
1188451975 X:30317058-30317080 GGGTTGCAGGATATGAATCAAGG - Intergenic
1188929434 X:36088357-36088379 GGGTTTCAACATATGAATTTGGG - Intronic
1189404015 X:40701866-40701888 GGGGTACAACATATGGATCTTGG - Intronic
1189563327 X:42213720-42213742 GGATTTCAACATATGAATCTAGG + Intergenic
1189769854 X:44414900-44414922 GGGTTTCACCATGTTGATCAAGG + Intergenic
1190608285 X:52167611-52167633 GGATTTCAAGATACGGATCTTGG + Intergenic
1190795002 X:53732623-53732645 TAGTTTCAAGATATGGATCTTGG + Intergenic
1191022155 X:55873582-55873604 GGGTTTCAAGATATGGATCTTGG - Intergenic
1191801523 X:65086494-65086516 AGGTTTCAACATATGGATTTCGG - Intergenic
1191896242 X:65996294-65996316 GGGTTTCAACATATGAATTTGGG + Intergenic
1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG + Intergenic
1195146222 X:102019665-102019687 GGGGTTCCAGATATGGAATATGG + Intergenic
1196095921 X:111799793-111799815 GGGTTTCAAGATATGGGTCTTGG + Intronic
1196187686 X:112762136-112762158 GGGCTTCAATATATGGATTTGGG + Intergenic
1196323235 X:114368956-114368978 AGGTTTCAACATATGAATCTAGG + Intergenic
1196758245 X:119176922-119176944 GAATTTCAAAATAAGGATCAGGG - Intergenic
1197702675 X:129611100-129611122 GTGTTTCAATATATGGATAAGGG + Intergenic
1197731912 X:129818004-129818026 GGGCTTCAACATATGGAACTGGG - Intronic
1197938153 X:131761786-131761808 GGGTTTCACCATGTGGGTCAGGG - Intergenic
1197956046 X:131949772-131949794 GGGTTTCAACATATGGATTTCGG - Intergenic
1198456011 X:136818685-136818707 GGGTTTCAAGATATGGATCTTGG - Intergenic
1198644134 X:138787907-138787929 GGATTTCAACATATGGATTTTGG + Intronic
1198644430 X:138790367-138790389 GAGTTTCAACATATGAATCTTGG + Intronic
1199229621 X:145422116-145422138 TGGTTTCAAGATATGGATAATGG - Intergenic
1199495067 X:148443576-148443598 GGGTCTCAACATATGAATTATGG + Intergenic
1199701927 X:150386069-150386091 GGATTTCAAGATATGGATCTTGG - Intronic
1200360280 X:155598080-155598102 GGGTTTCAAGATAGGAATATTGG + Intronic
1200708039 Y:6459388-6459410 GCATTTCAAGTTGTGGATCATGG - Intergenic
1200759107 Y:7020386-7020408 GGGTTTCACCATATTGACCAGGG - Intronic
1200967094 Y:9107615-9107637 GGGTTTCAAGGTTAGGATTAGGG + Intergenic
1201026073 Y:9705320-9705342 GCATTTCAAGTTGTGGATCATGG + Intergenic
1201337817 Y:12899190-12899212 GGGTTTCACCATATCGACCAGGG - Intergenic
1201453462 Y:14142154-14142176 GGGTTTCACCATATTGACCAGGG + Intergenic
1201624687 Y:16001872-16001894 GGGTTTCAACATATGCATGCTGG + Intergenic