ID: 932047335

View in Genome Browser
Species Human (GRCh38)
Location 2:68363017-68363039
Sequence CATTGAGCATGGTCCTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932047335 Original CRISPR CATTGAGCATGGTCCTGCTG GGG Intergenic
902203495 1:14851244-14851266 CATTGAGCCTGGGCCTGCCCAGG + Intronic
902554830 1:17240769-17240791 CCTTGTGCAGGGTCCTGCTGGGG + Intronic
902802125 1:18837019-18837041 CATGGGGCATGGTCATTCTGGGG + Intergenic
904421531 1:30397651-30397673 CCCTGAGCATGGTCCTGGTGAGG - Intergenic
907477306 1:54714367-54714389 CACTGACCTTGGTCCTGCAGAGG - Intronic
912687472 1:111778667-111778689 GGTTGAGCAGGGTCCTGTTGGGG - Intronic
916473576 1:165147138-165147160 CATTGACCATGAGCCTCCTGAGG - Intergenic
917298055 1:173542889-173542911 CATTGAGTATGATACTGCTGTGG - Intronic
918014552 1:180620473-180620495 CATTAAGCATGATCCTGGTGAGG + Intergenic
918408619 1:184235543-184235565 CATTGGGCAGGGTCTTGCTTAGG - Intergenic
920978441 1:210808457-210808479 AATTGAGCAAGGGCCTCCTGAGG - Intronic
1063519738 10:6730451-6730473 CATTGAACATGTGCTTGCTGTGG + Intergenic
1064319274 10:14287174-14287196 CATCAGGCATGGACCTGCTGAGG + Intronic
1069959218 10:72069888-72069910 CAGTGAGCAGGGGCCTTCTGGGG - Intronic
1070803330 10:79256065-79256087 CATTGAGGAGGCTCTTGCTGGGG + Intronic
1072768298 10:98114532-98114554 TAATGAACAGGGTCCTGCTGTGG + Intergenic
1076572623 10:131442519-131442541 GGCTGAGGATGGTCCTGCTGGGG + Intergenic
1077941320 11:6846585-6846607 CCTTGTGGAAGGTCCTGCTGAGG - Exonic
1078391489 11:10938901-10938923 CATTCAGTAAGGTCCTGCTGAGG - Intergenic
1078443442 11:11386268-11386290 CAATGAACATGGTACTGCTGTGG - Intronic
1089117147 11:116104832-116104854 CATTGACTATGGTCCAGCTTGGG - Intergenic
1089156433 11:116406499-116406521 CATTGCACATGGGCCTGCTTGGG - Intergenic
1089515122 11:119027303-119027325 CATTGAGCTTGGTCCTTAAGTGG - Intronic
1091829900 12:3542238-3542260 CATTAAGCCTGGACCTGCAGGGG + Intronic
1093118706 12:15242503-15242525 CCTTGAAAATAGTCCTGCTGAGG + Intronic
1096292570 12:50353545-50353567 CCCTGAGCCTGGGCCTGCTGAGG + Exonic
1096517259 12:52163882-52163904 CACTGAGCCTGTGCCTGCTGGGG + Intergenic
1099048042 12:77748303-77748325 CATTGTGCATGTTCCATCTGTGG + Intergenic
1100173218 12:92001020-92001042 TATTGAGAATGGTGCTGCTGGGG - Intronic
1100556709 12:95701720-95701742 CATTTAGCATGGTGCTTCTCAGG + Intronic
1104855814 12:131902081-131902103 CATTGTGTATGGGCCTCCTGGGG - Intronic
1108075933 13:46679849-46679871 CATTGAGCACTGTCCTGGTGAGG + Intronic
1110578146 13:77084612-77084634 CCTTGAGTATGGTCTTTCTGGGG + Intronic
1111961413 13:94814654-94814676 AATGGACCTTGGTCCTGCTGAGG + Intergenic
1112292347 13:98155805-98155827 CACTGCGCCTGGCCCTGCTGTGG + Intronic
1112621624 13:101059055-101059077 CATGGAGCCTGGTGCTGCTGGGG + Intronic
1115380190 14:32728098-32728120 CATTAGGCATGGACTTGCTGAGG + Intronic
1115641831 14:35340156-35340178 CACAGAGCAAGGTCCTGCTGAGG - Intergenic
1117148066 14:52855462-52855484 CATTGAATTTGGTCCTTCTGTGG - Intergenic
1125827662 15:42690066-42690088 CATTGGACATGGTCTTGCTTAGG - Exonic
1128893514 15:71352185-71352207 CATTCAGCATGTTCCTGGTTGGG - Intronic
1130099799 15:80884444-80884466 CATTTAGGATGGTACGGCTGTGG - Intronic
1133441049 16:5821098-5821120 CAATGAGTTTGGTCCTGATGGGG - Intergenic
1136544944 16:30949454-30949476 CTTTGAGCTTGGCCCGGCTGAGG - Exonic
1137846755 16:51697550-51697572 CATGGGGGATGGTCCTGCTCGGG - Intergenic
1139797296 16:69493809-69493831 CATTGTGAATAGTGCTGCTGTGG - Intergenic
1140378934 16:74469023-74469045 CATTGCGCACGGTCGTGCTCAGG + Exonic
1143860828 17:9889592-9889614 CAGCGTGCATGGTCCTGTTGGGG - Exonic
1143967625 17:10768076-10768098 CACTGAGAATGGTGCTGTTGGGG - Intergenic
1145768522 17:27476152-27476174 CACTGAGCATGGTCCCCCCGGGG - Intronic
1145828736 17:27897853-27897875 CACTGAGCTTCGTCCTGCTGGGG + Intergenic
1147144826 17:38478881-38478903 CAGTGGGCCTGGGCCTGCTGTGG + Intronic
1147480908 17:40762018-40762040 CACTGATCTTGGTCCTGCTGTGG - Intergenic
1147891320 17:43719344-43719366 CATTGAGCATGTTCTCTCTGAGG + Intergenic
1156091992 18:33482554-33482576 CAGTGAGCATGGTACTGGAGAGG + Intergenic
1156312563 18:35938184-35938206 CATTGACCACTGTCCTGCTCTGG + Intergenic
1156555419 18:38062700-38062722 CCTTCAGCATGGTCCTGCAAGGG - Intergenic
1157294943 18:46435634-46435656 CAGTGTTCATGGTCCTGCAGTGG + Intronic
1158162183 18:54497408-54497430 CCTTGACCGTGATCCTGCTGAGG + Intergenic
1158289458 18:55922991-55923013 CATTGACTGTGGTCCTGTTGTGG + Intergenic
1159067746 18:63588777-63588799 CAATTGGCATGGTCCTCCTGGGG + Exonic
1159334316 18:67043823-67043845 CATTGAGGCTGTTCATGCTGAGG - Intergenic
1160345019 18:78125043-78125065 CCTTCACCTTGGTCCTGCTGAGG - Intergenic
1161325886 19:3663926-3663948 CATTGTGAATTGTGCTGCTGAGG - Intronic
1163426427 19:17243359-17243381 GATTGAGCAGGGTCTCGCTGGGG - Intronic
1164574957 19:29400645-29400667 CAATGAGCAGGCTGCTGCTGAGG + Intergenic
1166789819 19:45392095-45392117 CATGGAGCAGGCCCCTGCTGTGG - Exonic
1167530937 19:50015988-50016010 CATTGAGCCTGTTTCTGCGGTGG - Intronic
1167902805 19:52634841-52634863 CACTGGGCATGGTCCTGGTAAGG - Intronic
925534706 2:4903841-4903863 CATTGAGCCTGGCCATGATGTGG + Intergenic
925939452 2:8802046-8802068 CACTGAGCTTGTTCCTGCTGTGG - Intronic
932047335 2:68363017-68363039 CATTGAGCATGGTCCTGCTGGGG + Intergenic
932551273 2:72772316-72772338 CCTTAAGCCTGGTCCTGCAGGGG - Intronic
935138869 2:100333459-100333481 CTTTGTGCATGCTCCTGCTAGGG + Intergenic
936941545 2:117889420-117889442 TATTGAGCAGGGTCCACCTGTGG - Intergenic
943701595 2:190993886-190993908 CACTGCGCTAGGTCCTGCTGGGG + Intronic
945310375 2:208305215-208305237 CACTGGGCATGGTGGTGCTGAGG - Intronic
946394486 2:219436252-219436274 CAGTGCTCATGGTCCAGCTGGGG + Intronic
948528279 2:238586970-238586992 CAGTGAGCAGAGTCCTGGTGTGG + Intergenic
948976850 2:241468681-241468703 CACAGGGCATGCTCCTGCTGGGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1173189033 20:40862282-40862304 CATTGAGCATCTACCTGCTCAGG + Intergenic
1173325152 20:42026483-42026505 CATTCAGCATGTTGCTGCTGTGG + Intergenic
1174125180 20:48299096-48299118 CATGGCGCCTGGTCCTGCCGGGG + Intergenic
1175332644 20:58175876-58175898 CATAGAGAAGGGTCCTGGTGTGG + Intergenic
1179560556 21:42213490-42213512 CACTGGGCATTGTCCTGGTGGGG - Intronic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1182038339 22:27216738-27216760 CTTGGAGCACAGTCCTGCTGGGG - Intergenic
1183472567 22:38017328-38017350 CATTGAGCATGATCACTCTGGGG - Intronic
1183831385 22:40420050-40420072 CTTTGAGGATGGTCAGGCTGAGG - Intronic
949577121 3:5349237-5349259 CATTGAGCAAGTTAGTGCTGAGG - Intergenic
954196840 3:49002083-49002105 CACTGAGCCTGGTCTTTCTGAGG + Intronic
954868936 3:53752173-53752195 CATTTACCATGGGCCTCCTGTGG + Intronic
956756026 3:72387672-72387694 TATTGGGCATGGTGCTGCGGTGG - Intronic
958196447 3:90247160-90247182 CATTGAGGATGATTCTGGTGAGG - Intergenic
958419639 3:93915793-93915815 CATTGAGGATGATTCTGGTGAGG - Intronic
959748727 3:109808282-109808304 TAGTTAGCAGGGTCCTGCTGTGG - Intergenic
960104353 3:113777935-113777957 CATTGAGGATGGGCTTGTTGTGG + Intronic
960360784 3:116708427-116708449 CAGGGAGGATGGTCCTGCTATGG - Intronic
960973755 3:123156771-123156793 CAGGGAGCGTGGTCCAGCTGAGG + Intronic
965606622 3:170503931-170503953 CATTTCCCAAGGTCCTGCTGGGG + Intronic
968407074 4:350157-350179 CACTGAGCTTGGTCTTACTGAGG - Intronic
969135501 4:5025576-5025598 CCTAGAGCTTGATCCTGCTGGGG - Intergenic
969357542 4:6639292-6639314 CACTGAACATGGGTCTGCTGGGG + Intergenic
970205512 4:13651732-13651754 CTTTGAGCCAGGTACTGCTGTGG - Intergenic
972019517 4:34293626-34293648 GATTCAGCAATGTCCTGCTGGGG - Intergenic
972338684 4:38131429-38131451 CATTGATGATGGTTTTGCTGAGG + Intronic
974091266 4:57313996-57314018 CAGTGTGCATGTTCCTGCTAAGG + Intergenic
975722404 4:77261205-77261227 CATTGAGCATGTTCCAGAGGTGG + Intronic
980086111 4:128391720-128391742 CATGGAGCATGGTACTATTGTGG + Intergenic
984021776 4:174493985-174494007 CGATGTGCATGTTCCTGCTGAGG + Intronic
988123068 5:26992730-26992752 CATTGAGGATGATTCTGGTGAGG + Intronic
990693914 5:58393650-58393672 AATTGAGGATTGTCCTGTTGGGG + Intergenic
992185807 5:74243045-74243067 CTTGGAGCATGGTCTTGCAGGGG + Intergenic
996748543 5:126867012-126867034 CATGAAGCCTGGTGCTGCTGAGG - Intergenic
1002643451 5:180641360-180641382 CAGAGAGCATGGCCCTGCGGTGG + Intronic
1003277461 6:4664731-4664753 CTTTCAACAGGGTCCTGCTGTGG - Intergenic
1007524587 6:42480664-42480686 CAGTGAGCAGGCTACTGCTGTGG - Intergenic
1011945048 6:92890563-92890585 CTTTGAGCCTGGTTCTGCAGGGG + Intergenic
1013300278 6:108798823-108798845 CACTGAGCCCGCTCCTGCTGCGG - Intergenic
1015589504 6:134809190-134809212 CTTTGAGCAGGGTCCAGCGGCGG - Intergenic
1018188284 6:161286899-161286921 CAGCCAGCATGCTCCTGCTGCGG - Intergenic
1018654721 6:166024431-166024453 CACAGAGCTTGCTCCTGCTGGGG - Intergenic
1022274373 7:28841359-28841381 CAGTGGCCATGGTGCTGCTGGGG + Intergenic
1024203320 7:47128278-47128300 CAAAGAGCAAGGTCTTGCTGTGG + Intergenic
1024207047 7:47172785-47172807 CAGTGAGCATGGTACAGGTGTGG + Intergenic
1030006523 7:105125843-105125865 CATTGATCATTGAACTGCTGGGG - Intronic
1034102311 7:148460237-148460259 CATAGAGCATGGTCCAGGTGAGG - Intergenic
1034353528 7:150432944-150432966 CACTGAGCTTGATCCTGCTGGGG + Intergenic
1035285858 7:157806908-157806930 CCCTGAGCTTGGTGCTGCTGAGG - Intronic
1037744827 8:21634518-21634540 CATTAAGCATGATTCTGGTGAGG + Intergenic
1038131127 8:24732697-24732719 CATTGAGCCTGGTCCTGGGTTGG + Intergenic
1039980500 8:42406068-42406090 CAGTGAACATGGTTGTGCTGGGG + Intergenic
1040659796 8:49557809-49557831 CATTGAATATGATTCTGCTGAGG + Intergenic
1041890712 8:62865019-62865041 CATTGATCATTGAACTGCTGGGG + Intronic
1046550834 8:115714195-115714217 CTTTGAGCATGTTGCTGTTGAGG - Intronic
1047095794 8:121624369-121624391 CAATGTGCATGTTCCAGCTGAGG - Intronic
1048062729 8:130937112-130937134 CAGTGGGCATGGTCCTGGCGGGG + Exonic
1048633886 8:136274596-136274618 TGTAGAGCTTGGTCCTGCTGGGG - Intergenic
1049351981 8:142169548-142169570 CCTTGAGGAAGGGCCTGCTGAGG - Intergenic
1049556178 8:143283359-143283381 CATTGATCATGGGCCTGGTTCGG + Intergenic
1055552707 9:77446033-77446055 CAGTGACCAGGGCCCTGCTGGGG + Intronic
1056535918 9:87527519-87527541 AATAGAGCTTGCTCCTGCTGAGG + Intronic
1060797934 9:126525047-126525069 CTTTGAGCTTGGTCCCCCTGCGG - Intergenic
1062026716 9:134343980-134344002 CATGGGGCCTGGTCCTGCTGAGG + Intronic
1188862227 X:35271548-35271570 CAATGAGCATGGGACTGCAGAGG + Intergenic
1189121736 X:38402356-38402378 CATTGCACAAGGTCCTGCAGGGG - Intronic
1189279372 X:39810449-39810471 CAATGAGCAGGTTACTGCTGTGG + Intergenic
1196828737 X:119759895-119759917 CAGGGAGCGTGGTCCTGCTTGGG + Exonic
1199880826 X:151973422-151973444 CATTTATCAAGCTCCTGCTGAGG + Intronic