ID: 932048208

View in Genome Browser
Species Human (GRCh38)
Location 2:68371408-68371430
Sequence CTGGTTTACCTGCAGCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932048202_932048208 30 Left 932048202 2:68371355-68371377 CCTCCAACAGTTAGAGAGATGAT 0: 1
1: 0
2: 0
3: 8
4: 128
Right 932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 288
932048203_932048208 27 Left 932048203 2:68371358-68371380 CCAACAGTTAGAGAGATGATACC 0: 1
1: 0
2: 1
3: 2
4: 85
Right 932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 288
932048205_932048208 6 Left 932048205 2:68371379-68371401 CCATCTTGGTGTTCTGCTTTGAA 0: 1
1: 0
2: 5
3: 16
4: 282
Right 932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG 0: 1
1: 0
2: 1
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932048208 Original CRISPR CTGGTTTACCTGCAGCTTTG AGG Intronic
903886424 1:26543491-26543513 CTGATTTGACTGCAGTTTTGTGG + Intronic
905448891 1:38045023-38045045 CTGCGTTACCTGTCGCTTTGGGG + Exonic
905474780 1:38218316-38218338 CTGGCTTGTGTGCAGCTTTGTGG - Intergenic
906911533 1:49957264-49957286 CTGCTTTACCTCCAACTATGTGG + Intronic
908168750 1:61484222-61484244 TTGGTTTCTCTGCAGCTCTGGGG + Intergenic
908168761 1:61484293-61484315 TTGGTTTCTCTGCAGCTCTGGGG + Intergenic
908168798 1:61484540-61484562 TTGGTTTCTCTGCAGCTCTGGGG + Intergenic
915807094 1:158865343-158865365 CTGGTTTCTCTTCATCTTTGTGG - Intergenic
916738631 1:167629788-167629810 CTGGTTTCCCTGCAGTTCTTGGG - Intergenic
916954919 1:169822191-169822213 CTGGGTTCCCTGCAGCTTGCAGG - Intronic
917009660 1:170457156-170457178 CTGGTTTTTCTTCATCTTTGTGG + Intergenic
917111683 1:171555577-171555599 CTGGTTTCTCCCCAGCTTTGTGG + Intronic
917181537 1:172302908-172302930 CTGGTTTCTCCCCAGCTTTGTGG - Intronic
917207653 1:172594685-172594707 GTGCTTTACCTCCAGCTATGTGG + Intronic
919043327 1:192420698-192420720 CTGCTTTACCTGCAGCTCCCTGG - Intergenic
922177333 1:223206813-223206835 CAGGTTAACCTGTAGCTTTGGGG + Intergenic
922214979 1:223512712-223512734 ATGGTTTCCCTGCAGTTTGGGGG - Intergenic
922824333 1:228506711-228506733 CTGTTTTTCCTCCATCTTTGTGG - Intergenic
922848253 1:228707693-228707715 CTGGTTTTTCTCCATCTTTGTGG - Intergenic
1063544371 10:6965903-6965925 CTTGTTTTCCTGCACCTTTCAGG + Intergenic
1064254184 10:13730073-13730095 CTGGTTTGTCTGCAGGTCTGGGG + Intronic
1064367939 10:14725128-14725150 CAGCTTTTCCTGCAGCCTTGTGG - Intronic
1064504164 10:16011193-16011215 ATTCTTTACCTGCAGATTTGGGG - Intergenic
1064518544 10:16176687-16176709 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1064621422 10:17221549-17221571 CTGGTTTTCCTGCAACTATATGG - Intergenic
1064635891 10:17366680-17366702 CTGGGTCACCTGTAGATTTGGGG - Intronic
1066268990 10:33803619-33803641 CTGGGTTGACTGAAGCTTTGTGG - Intergenic
1066755159 10:38703994-38704016 CTGGTTTCCCCCCATCTTTGTGG - Intergenic
1067127520 10:43532573-43532595 CTAGTTTCTCTGCATCTTTGTGG + Intergenic
1067858386 10:49818048-49818070 CTGGTTTACCATCAGCTGTCAGG - Intergenic
1067941214 10:50658901-50658923 CTGCAGTGCCTGCAGCTTTGAGG + Intergenic
1068516909 10:58036457-58036479 CTGGTTTTTCTTCATCTTTGTGG + Intergenic
1069373469 10:67770540-67770562 ACTGTTTTCCTGCAGCTTTGGGG + Intergenic
1070862436 10:79683773-79683795 CTGCAGTGCCTGCAGCTTTGAGG + Intergenic
1071066628 10:81644055-81644077 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1072735133 10:97874051-97874073 CTGGAATACCTGGAGCTTTCTGG + Intronic
1072929112 10:99645667-99645689 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1075570869 10:123543536-123543558 CTTTTTTCCCTGCTGCTTTGAGG - Intergenic
1075722760 10:124597112-124597134 CTGGTTTAGCTGGAGCTCTCGGG + Intronic
1078423156 11:11228748-11228770 TGAGTTTACCTGCAGCTATGAGG - Intergenic
1079463616 11:20707476-20707498 CTGGTTTCTCTCCATCTTTGTGG + Intronic
1080118058 11:28642287-28642309 CTGGTTTTTCTCCATCTTTGTGG - Intergenic
1080346754 11:31334493-31334515 CTAGTTTCCCTCCATCTTTGTGG + Intronic
1081158978 11:39730397-39730419 CTGGGTTACTTGTAGTTTTGTGG - Intergenic
1082127718 11:48452928-48452950 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1082136819 11:48558688-48558710 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1082490874 11:53532118-53532140 CTGGCTTCCCTGCAGGGTTGGGG + Intergenic
1082614187 11:55338586-55338608 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1082666135 11:55978434-55978456 CTGATTTACTTGCACCTGTGTGG - Intergenic
1083165358 11:60881775-60881797 CTGGTTTATCCCCATCTTTGTGG - Intergenic
1083510335 11:63203187-63203209 CTGGTTTTTCTTCATCTTTGTGG - Intronic
1083815352 11:65129755-65129777 CTGGTTGATCTGCAGCATGGCGG + Exonic
1085076880 11:73598860-73598882 CTGGTCTCCCTGCAAATTTGAGG + Intergenic
1087119065 11:94553974-94553996 CTGGTTTACCAGGAGGCTTGTGG + Intronic
1088385335 11:109248035-109248057 CAGTATTACCTGCAGTTTTGGGG + Intergenic
1088904738 11:114146305-114146327 CTGGTTTTCCTGCCCCTTTCAGG + Intronic
1089269755 11:117293926-117293948 CTCTTCTCCCTGCAGCTTTGTGG - Exonic
1090985862 11:131765518-131765540 TTGATTTACATGAAGCTTTGAGG - Intronic
1091630706 12:2158584-2158606 CTGATTTACCCGCAGCCATGTGG + Intronic
1092096943 12:5850536-5850558 CTGTTTTATCTGCAGCCTTGGGG + Intronic
1092172274 12:6381410-6381432 CTGGTTTGCTTGCAGGTCTGTGG - Intronic
1095442672 12:42253992-42254014 CTGGTTTATCCCCATCTTTGTGG + Intronic
1095832233 12:46600694-46600716 CTGGTTTTTCTTCACCTTTGTGG + Intergenic
1098159850 12:67639501-67639523 CTGGTTTACTGGCAGCCCTGGGG - Intergenic
1101636842 12:106551018-106551040 CTGGTTTATCACCATCTTTGTGG + Intronic
1107031327 13:35857009-35857031 CTGGTTTACCTGTAGGTTAAAGG - Intronic
1107826060 13:44330151-44330173 CTGGTTTCCCTGCAGATCGGGGG + Intergenic
1110585415 13:77185363-77185385 CTGCTTTTCCTGTAGCTTTGAGG + Exonic
1111071374 13:83172175-83172197 CTGGTTTATCCCCATCTTTGTGG - Intergenic
1112774829 13:102832823-102832845 CTGGTAAACTTGCATCTTTGTGG + Intronic
1113670953 13:112175839-112175861 CTGGATTCCCTGCATCTTTGGGG + Intergenic
1113780851 13:112976597-112976619 CTGGGTCACCTGCACCTCTGAGG + Intronic
1114603022 14:23971027-23971049 CTGGTTTCTCTCCATCTTTGTGG - Intronic
1114607384 14:24008153-24008175 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1114796455 14:25720647-25720669 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1115294570 14:31811731-31811753 CTGGTTTCTCTCCATCTTTGTGG + Intronic
1116074246 14:40089538-40089560 CTGGTTTTCCCCCATCTTTGTGG - Intergenic
1117614371 14:57518660-57518682 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1117930424 14:60836348-60836370 CTGGTTTTTCTTCATCTTTGTGG + Intronic
1119066237 14:71529939-71529961 CTGGTGTAGCTGCAGCATTGTGG + Intronic
1121712726 14:96051567-96051589 CTTGGTTTCCAGCAGCTTTGAGG + Intronic
1122077972 14:99247806-99247828 CCTGTTTGCCTGCACCTTTGAGG + Intronic
1122386965 14:101355478-101355500 CTGCTCTTCCTGCAGCTTGGTGG - Intergenic
1122827293 14:104376468-104376490 CTGGTTTGCCTGTAGCTTGGAGG + Intergenic
1123126586 14:105951083-105951105 CAGGTTTACCTCCCTCTTTGTGG - Intergenic
1123480941 15:20630115-20630137 CTGGTTTATCCTCATCTTTGTGG - Intergenic
1123637070 15:22370250-22370272 CTGGTTTATCCTCATCTTTGTGG + Intergenic
1126524103 15:49631007-49631029 CTGGTTTTCCTGCAACTTGATGG - Intronic
1126638308 15:50800938-50800960 CTGTTTCACCCACAGCTTTGGGG - Intergenic
1127253761 15:57270675-57270697 CTGGTTTCTCCCCAGCTTTGTGG + Intronic
1127317759 15:57814231-57814253 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1127331908 15:57948023-57948045 CTGCTCCTCCTGCAGCTTTGGGG + Intergenic
1128642228 15:69348087-69348109 CTGGTTTGCCTGAAGGTCTGTGG - Intronic
1128707117 15:69844380-69844402 CTGGTTTCCATGAAGGTTTGGGG - Intergenic
1130387482 15:83424278-83424300 CTGATTTTCCTTCAGCTCTGTGG + Intergenic
1131345427 15:91643390-91643412 TTGGTTCCCCTGCAGATTTGGGG + Intergenic
1133661995 16:7927404-7927426 CTGGTGTTCCTGTAGCTGTGGGG + Intergenic
1135094642 16:19555168-19555190 CTGCTTTACCCACTGCTTTGCGG - Intergenic
1136727522 16:32372850-32372872 CTGGTTTCCCCCCATCTTTGTGG + Intergenic
1137925960 16:52542288-52542310 ATGGTTTACATGCAACTATGTGG - Intronic
1140045907 16:71440671-71440693 CTGGGACACCTGCAGCTGTGTGG - Intergenic
1142116808 16:88361053-88361075 CTTGTTTTCCTGCAGCTAGGTGG + Intergenic
1202998911 16_KI270728v1_random:144900-144922 CTGGTTTCCCCCCATCTTTGTGG - Intergenic
1203130509 16_KI270728v1_random:1681308-1681330 CTGGTTTCCCCCCATCTTTGTGG - Intergenic
1142595980 17:1030262-1030284 CCAGTTTACCTGCCCCTTTGAGG - Intronic
1142682133 17:1556368-1556390 ATGGTTTTTCTGCAGCATTGAGG - Intronic
1143450165 17:7031636-7031658 CTGGGTTGCCTGAAGCCTTGGGG - Intergenic
1147334605 17:39719772-39719794 CTGTTTCTCCTGCAGCTGTGTGG + Exonic
1148677100 17:49451870-49451892 CTGGTTTACTTGAGGCTGTGGGG - Intronic
1149236116 17:54593144-54593166 CTGGTTTCTCTTCATCTTTGTGG + Intergenic
1151473862 17:74334302-74334324 CTTGTTAACCTGCAGATTTATGG + Intronic
1153060490 18:990081-990103 CTGGAGTACCCCCAGCTTTGTGG + Intergenic
1153941393 18:9981715-9981737 CTGGTTTATCCCCATCTTTGTGG + Intergenic
1155993473 18:32305063-32305085 CTTGTTTTCCTGCATATTTGTGG - Intronic
1156626757 18:38919367-38919389 CTGGTTTATCCTCATCTTTGTGG + Intergenic
1156725208 18:40119167-40119189 CTGTTTTTTCTGCATCTTTGTGG + Intergenic
1158451311 18:57568187-57568209 CCGGTTGACCTGCAGCACTGGGG - Intronic
1158526808 18:58221725-58221747 CTTGTTTTTCAGCAGCTTTGAGG + Intronic
1158562189 18:58523926-58523948 GTGGTTTACCTTCAGCTGTGAGG + Exonic
1158703801 18:59772339-59772361 CTGGTTTCCCCCCATCTTTGTGG - Intergenic
1158965194 18:62616486-62616508 CTGGTTGATCTGCAGCTTCGTGG - Intergenic
1159683178 18:71381158-71381180 CTGGTTTGCCAGCGGCTTTCAGG - Intergenic
1159975320 18:74704194-74704216 CTGGTTTACCAGAAGATTTAGGG - Intronic
1162244637 19:9389637-9389659 CTGGTTACTCTGCAGTTTTGGGG + Intergenic
1164321526 19:24152655-24152677 CTGTTTTTTCTGCATCTTTGTGG + Intergenic
1164542841 19:29133611-29133633 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1164702950 19:30298684-30298706 CTGGCATACCTGCAGATATGGGG - Intronic
1165943766 19:39428956-39428978 CTGATTTAGCTGTAGCTCTGAGG - Intergenic
1166263304 19:41658070-41658092 CTGGTTTATCCTCATCTTTGCGG - Intronic
1168407405 19:56118104-56118126 CTGGTTTCTCTGCAGCTGTAAGG + Intronic
927239676 2:20910573-20910595 CTGTTTTTTCTGCATCTTTGTGG + Intergenic
929025645 2:37599279-37599301 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
930359439 2:50359135-50359157 CTGGTTTTTCTTCATCTTTGTGG - Intronic
930729113 2:54710299-54710321 CTGGTCTAGCAGCAGCCTTGCGG + Intergenic
931460794 2:62448533-62448555 CTTGCTTAGCTGCAGCCTTGGGG - Intergenic
931558578 2:63531739-63531761 CTGGTTTCCCCCCATCTTTGTGG - Intronic
932048208 2:68371408-68371430 CTGGTTTACCTGCAGCTTTGAGG + Intronic
932642349 2:73461491-73461513 CTGTTTTTTCTGCATCTTTGTGG - Intronic
935822734 2:106910200-106910222 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
936074775 2:109394815-109394837 CTGGCTTCCCTGCAGCATGGAGG + Intronic
936268584 2:111030608-111030630 CTTGCTTCCCTGCAGCTCTGCGG - Intronic
936312447 2:111397152-111397174 CTGCTTTACCTGCAGTACTGGGG + Intergenic
937632998 2:124123938-124123960 CTGGTTTCTCTCCATCTTTGTGG - Intronic
938975157 2:136469724-136469746 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
939019842 2:136946073-136946095 CTGGTTTCTCTCCATCTTTGTGG + Intronic
939250007 2:139671165-139671187 ATGGTTAACCTGCAACTTTAGGG - Intergenic
940437417 2:153670579-153670601 CTGGTTTCTCTCCATCTTTGCGG - Intergenic
942902556 2:181139275-181139297 CTGGTTTTCCTGCAGGTATAGGG + Intergenic
944600809 2:201300958-201300980 CTGGTTTCCCCCCATCTTTGTGG - Intronic
946708403 2:222482090-222482112 CTACTTCACCAGCAGCTTTGAGG + Intronic
948640173 2:239370694-239370716 CTGGTGCACCTGCAGCCCTGCGG + Intronic
1169649822 20:7854667-7854689 CTAGGTGACCTGCAGATTTGGGG - Intergenic
1170015102 20:11771581-11771603 CTGGTTTTCCTGCTACTTTGTGG + Intergenic
1170332303 20:15227029-15227051 TTGATTCACCTCCAGCTTTGTGG + Intronic
1171268069 20:23789485-23789507 CTGCTTTTTCTGCATCTTTGTGG - Intergenic
1171377569 20:24703809-24703831 CTCGTTTACATGCAGATTTTGGG + Intergenic
1172746565 20:37214401-37214423 CTTATTTACCTGATGCTTTGTGG + Intronic
1174505762 20:51016478-51016500 CTGGTTCTCCTCCAGCTTGGGGG + Intronic
1176810355 21:13530363-13530385 GTGGTTGACCTGCAACTTTTTGG - Intergenic
1179192276 21:39133529-39133551 CTGGTTGCCCTCCAGCCTTGTGG - Intergenic
1179537920 21:42064101-42064123 CTGATTCACCAGCAGCCTTGGGG - Intronic
1179614914 21:42576572-42576594 CTCTTTTATCTGCAGTTTTGGGG - Intronic
1179681663 21:43026048-43026070 CTTGTTTTCCTGGAGCTATGTGG + Intronic
1180127634 21:45803125-45803147 CTGGTGTGCCTGCAGCTGTGTGG + Intronic
1180306633 22:11131909-11131931 CTGGTTTCCCCCCATCTTTGTGG - Intergenic
1180545151 22:16494092-16494114 CTGGTTTCCCCCCATCTTTGTGG - Intergenic
1181453117 22:23037253-23037275 CTAGTTCAGCTGCACCTTTGCGG - Intergenic
1183456915 22:37927807-37927829 CACCTTTACCTGCAGCTGTGGGG - Exonic
1184518140 22:44975661-44975683 CTGATTTGGCCGCAGCTTTGGGG - Intronic
1185334978 22:50267378-50267400 CTGGTTTACCAGCTGCTGCGCGG - Exonic
949804097 3:7935212-7935234 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
950792542 3:15485005-15485027 CTGGTTTCTCTCCATCTTTGTGG + Intronic
951469003 3:23035515-23035537 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
952517599 3:34121683-34121705 CTGGTTTCTCTTCATCTTTGTGG + Intergenic
952813887 3:37430467-37430489 CTGGTTTTTCTCCATCTTTGTGG + Intronic
953102225 3:39841566-39841588 CTGGTTTTCCCTCATCTTTGTGG + Intronic
953315983 3:41926376-41926398 CTGGTTTCTCTCCATCTTTGTGG - Intronic
953996235 3:47522183-47522205 CAGGTTCACCTTCAACTTTGTGG - Intergenic
959479478 3:106853911-106853933 CTGGTTTTCCCTCATCTTTGTGG - Intergenic
959981561 3:112523513-112523535 CTGATTTACTTGCACCTGTGTGG - Intergenic
961432948 3:126896101-126896123 CAGTTTTACATGAAGCTTTGAGG + Intronic
962233019 3:133682235-133682257 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
962645209 3:137431531-137431553 CTGGTTTATCCCCATCTTTGTGG - Intergenic
963127298 3:141827580-141827602 CTGGTCCATCTGCAGTTTTGAGG - Intergenic
963158097 3:142120899-142120921 CTGCTTTACCAGCAGCTCTGGGG + Intronic
963272678 3:143301368-143301390 CTGATTTCTCTGCAGCTCTGGGG - Intronic
964556715 3:157947659-157947681 CTGCTTCAGATGCAGCTTTGGGG - Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967311840 3:188113574-188113596 CTGGTTTTCCTGCATCTTTCAGG + Intergenic
969178575 4:5419781-5419803 CTGTTTTATATGCAGATTTGGGG + Intronic
973583627 4:52370007-52370029 CTGGTTTCCCTGCTGCTTGTGGG + Intergenic
974979373 4:68935589-68935611 CTGGTTTCTCTCCATCTTTGTGG - Intronic
975843925 4:78505842-78505864 CTGGTTTATCCCCATCTTTGTGG + Intronic
976507277 4:85862961-85862983 CTGTTTTAATGGCAGCTTTGAGG - Intronic
977486713 4:97657660-97657682 GTGGTTTACCTACAGATTTTAGG + Intronic
981208054 4:142067357-142067379 CTGGTTTATCCCCATCTTTGTGG - Intronic
983020097 4:162665493-162665515 ATGGTTTACCAGGGGCTTTGGGG + Intergenic
983730847 4:170991788-170991810 CTGGCTTCCCTGCAGGGTTGGGG - Intergenic
985187496 4:187333267-187333289 CTACTGTACCTGCAGCTTTCAGG - Intergenic
985561770 5:591111-591133 CTGCTTTGCCAGCATCTTTGTGG + Intergenic
985806104 5:2044554-2044576 GTGGTTTGCCAGCAGTTTTGGGG - Intergenic
986228358 5:5838563-5838585 CTGGTGTTTCTGCAGCCTTGTGG - Intergenic
986653974 5:9991753-9991775 CTGGTTTCTCCCCAGCTTTGTGG - Intergenic
987445091 5:18007040-18007062 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
987838104 5:23187157-23187179 CTGGTTTTCCCCCATCTTTGTGG - Intergenic
988970916 5:36466263-36466285 CTGGTTTTTCTTCATCTTTGTGG - Intergenic
989584187 5:43061722-43061744 CTGGGATACCTGCAGCTTGAAGG - Intergenic
990749596 5:59000118-59000140 ATGGTATCCCTGCAGCTCTGAGG + Intronic
992973233 5:82083858-82083880 CTTGTTTCTCTGCATCTTTGTGG - Intronic
993578826 5:89635038-89635060 CTGGTTTCCCCCCATCTTTGTGG + Intergenic
993947905 5:94137564-94137586 CTGGTTTCCCCCCATCTTTGTGG + Intergenic
994039767 5:95245204-95245226 CTGGTTTCTCTCCATCTTTGTGG - Intronic
995813756 5:116142075-116142097 ATGGATTACCTGCATCTTTGTGG - Intronic
996360344 5:122638455-122638477 CTGGCTTCTCTGCAGCCTTGGGG - Intergenic
998946134 5:147341266-147341288 CTGGTTTATCTCTAGCTTTATGG + Intronic
999489720 5:152038450-152038472 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1000142870 5:158423419-158423441 CTGATTTAGCTGTAGCTTAGAGG + Intergenic
1000412230 5:160946197-160946219 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1001104413 5:168840945-168840967 TTGATTTACCTTCAACTTTGTGG + Intronic
1001746469 5:174096446-174096468 CTGGGGTACCTGGAGCTTGGAGG + Intronic
1002170079 5:177370041-177370063 CTGGTTTCACAGCAGTTTTGAGG + Intronic
1003228760 6:4230039-4230061 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1003272737 6:4621674-4621696 GTGGTTTTCCTGCAGATGTGGGG - Intergenic
1003987659 6:11452835-11452857 CTGGTTTATCCCCATCTTTGTGG - Intergenic
1004331705 6:14728028-14728050 GTTATTGACCTGCAGCTTTGGGG - Intergenic
1004595425 6:17094851-17094873 CTGATTTTCCTAAAGCTTTGTGG + Intergenic
1005747234 6:28849469-28849491 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1006310522 6:33255362-33255384 CTGGTTTAAGTGCATCTTTGTGG + Intronic
1006646304 6:35516681-35516703 CAGCTTTACCTGTAGTTTTGAGG - Intergenic
1008381359 6:50842523-50842545 CCTGTTTACCTGCAGTATTGGGG - Intronic
1009410861 6:63363229-63363251 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1009868423 6:69427004-69427026 CTTGAAAACCTGCAGCTTTGTGG - Intergenic
1009923512 6:70092442-70092464 CTGTTTTACCTGCTGTGTTGGGG - Intronic
1009979971 6:70716255-70716277 CTTGTTTTCCTGCAGCTATATGG + Intronic
1011838836 6:91470078-91470100 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1011906307 6:92372873-92372895 CTAGTTTACTTCCAGGTTTGTGG - Intergenic
1011919748 6:92557986-92558008 CTCGTTTCCCTGCAGGTTTTTGG - Intergenic
1012321173 6:97848072-97848094 CTGGGTTACCTGGAGATCTGAGG + Intergenic
1012608703 6:101189155-101189177 CTGGTTTATCCCCATCTTTGTGG - Intergenic
1012881919 6:104800744-104800766 CTGGTTTCTCTCCATCTTTGTGG - Intronic
1013695081 6:112692371-112692393 CTGGGGTACCTGTAGCATTGTGG + Intergenic
1014184766 6:118422058-118422080 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1019307296 7:341901-341923 CTAGTTCACCTGCACCTGTGTGG + Intergenic
1023294071 7:38697039-38697061 CTGGTTTCTCTGCAGCTGTAAGG - Intergenic
1023472534 7:40539980-40540002 CTGGTTTTCCTACTGGTTTGAGG + Intronic
1023651104 7:42370536-42370558 CTGGTTTCTCTGCATCTTTGTGG + Intergenic
1027493558 7:78860351-78860373 CTGGTTTATCCCCATCTTTGTGG + Intronic
1030513953 7:110518744-110518766 CTGGTCCAGCTGCAGCCTTGTGG - Intergenic
1031728546 7:125267800-125267822 CTAATGAACCTGCAGCTTTGAGG + Intergenic
1033539000 7:142338819-142338841 CAGGGTTCCCTGCAGCATTGTGG - Intergenic
1037003570 8:13749415-13749437 TTGGTTTACCTACAGCTCTGAGG - Intergenic
1037212233 8:16404552-16404574 CAGCTTTACCTGATGCTTTGAGG - Intronic
1037609338 8:20463353-20463375 CTGTTTGACTTGCAGCTTTTGGG + Intergenic
1037766216 8:21774038-21774060 CTCGTTTACATGCAGTTTTGTGG - Intronic
1038342802 8:26701909-26701931 CTAGTTTCTCTGCTGCTTTGTGG + Intergenic
1039469200 8:37803072-37803094 CTGGTTTGCCTGTGCCTTTGGGG - Intronic
1039618438 8:38975105-38975127 GTGGTTCACGTGCAGCTGTGGGG + Exonic
1039650053 8:39331853-39331875 CTGGTTTGTCTGCAGCTTGGTGG - Intergenic
1040383453 8:46894975-46894997 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1041583846 8:59494237-59494259 CTGGTTTTCCCTCATCTTTGTGG + Intergenic
1042521765 8:69720237-69720259 CTGGTTCACATGTATCTTTGGGG - Intronic
1042645189 8:70979349-70979371 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1044440746 8:92221173-92221195 CTGGTTTTCCCCCATCTTTGTGG + Intergenic
1045088299 8:98711170-98711192 CTGTTTTTTCTGCATCTTTGTGG - Intronic
1045143444 8:99313274-99313296 CTGTTTTTTCTGCATCTTTGTGG + Intronic
1045969315 8:108061771-108061793 GTGCTTTACCTGCAACTATGTGG - Intronic
1047818161 8:128487766-128487788 CTAGCTTACATGCAGCTTTATGG + Intergenic
1047901836 8:129431531-129431553 CTGGTTTGCCTCCAGCCTGGAGG + Intergenic
1047931647 8:129733699-129733721 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1049804376 8:144532345-144532367 CTGGTCCACCTGCAGCTTCAGGG + Exonic
1050343972 9:4667976-4667998 CTGGTTTCCCTCCAACTTTCTGG + Intergenic
1051489551 9:17646487-17646509 CTGGTTTTCCCTCATCTTTGTGG + Intronic
1051940107 9:22495558-22495580 CTGGTTTATCCTCATCTTTGTGG + Intergenic
1053353281 9:37427252-37427274 ATGGTGGACCTGCAGCTTTCAGG - Intronic
1055338865 9:75261070-75261092 CTGGTTTTCCCTCATCTTTGTGG + Intergenic
1055505794 9:76947578-76947600 TTGGTTTATTTGCAGGTTTGGGG + Intergenic
1056997051 9:91472816-91472838 CTGGTTTCTCCCCAGCTTTGTGG + Intergenic
1058183224 9:101823167-101823189 CTGGAATACCTGCAGCTTAGTGG - Intergenic
1058202904 9:102066292-102066314 CTGGTTTCTCTACATCTTTGTGG + Intergenic
1061869097 9:133510861-133510883 CTTGTTAACTTGCAGCGTTGGGG + Intergenic
1185755756 X:2651761-2651783 CTGGGTCTCCTGAAGCTTTGGGG + Intergenic
1185806320 X:3060341-3060363 CTGGTTTCTCTCCATCTTTGTGG - Intronic
1186937116 X:14462958-14462980 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1187374416 X:18739241-18739263 CTGGTTTCTCCGCATCTTTGTGG + Intronic
1187635572 X:21224361-21224383 CTGGTTTCTCTCCACCTTTGTGG + Intergenic
1188123198 X:26335017-26335039 CTGGTTTCTCTTCATCTTTGTGG - Intergenic
1188425664 X:30043976-30043998 CTGATTTACCTGAACCATTGTGG + Intergenic
1189754248 X:44254148-44254170 CTGGTTTTTCTTCATCTTTGTGG - Intronic
1189867330 X:45344672-45344694 CTGTTTTACTTGAAGATTTGAGG - Intergenic
1191003698 X:55688219-55688241 CTGGTTTATCCCCATCTTTGTGG + Intergenic
1191592608 X:62904590-62904612 CTGCTTTACTTCCAGCTATGTGG + Intergenic
1192753223 X:74016692-74016714 CTTGTTTTCTTGCAGCTTTTAGG - Intergenic
1193003553 X:76590555-76590577 CTGGTTTCTCTCCAGCTTTATGG + Intergenic
1193431176 X:81407856-81407878 CCGCTTTACCTTCTGCTTTGGGG + Intergenic
1194508970 X:94768660-94768682 CTGGTTTATCCCCATCTTTGTGG + Intergenic
1195335027 X:103844416-103844438 CTGGGTTAACTGCAGCTGAGAGG - Intergenic
1195372680 X:104194989-104195011 CTGTTTTCCCTGAAGCTGTGAGG + Exonic
1195580164 X:106492940-106492962 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1196926956 X:120642972-120642994 CTGGTTAAAATGCAGCTATGAGG - Intergenic
1197478093 X:126947813-126947835 CTGGTTTCTCTCCATCTTTGTGG - Intergenic
1197486305 X:127055919-127055941 CTGGTTTCTCTCCATCTTTGTGG + Intergenic
1197874143 X:131086152-131086174 CAGTTGTACCTGCATCTTTGAGG + Intronic
1198059129 X:133026192-133026214 CAGGTTTACCTCCAGCTTTGTGG + Exonic
1198372648 X:136005995-136006017 CTGCTTTCCCTTCAGCTTTTGGG - Intronic
1198493308 X:137165537-137165559 TAGGTTTTCCTCCAGCTTTGAGG + Intergenic
1199614898 X:149648499-149648521 CTGGTCCAGCTGCAGGTTTGTGG + Intergenic
1199743297 X:150756157-150756179 CTACTTTACCTGCAGATATGGGG + Intronic
1201332279 Y:12837452-12837474 CTTGTTTTCCTGCAGCTATATGG + Intronic
1201974954 Y:19839197-19839219 CTGTTTTTCCTCCATCTTTGTGG + Intergenic