ID: 932048610

View in Genome Browser
Species Human (GRCh38)
Location 2:68376484-68376506
Sequence ATGATCCTATAGACCTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932048610 Original CRISPR ATGATCCTATAGACCTCTGC AGG (reversed) Intronic
917679651 1:177353010-177353032 AAGACCTCATAGACCTCTGCTGG - Intergenic
919876960 1:201876321-201876343 CTGTTCCTAGAGCCCTCTGCTGG + Exonic
920063227 1:203243471-203243493 ATGATCATATAGACAGATGCAGG + Intronic
920842893 1:209569623-209569645 ATGAGACTATCGCCCTCTGCTGG - Intergenic
1065940293 10:30558323-30558345 ATGATGCTATAGATCTATTCAGG + Intergenic
1078793149 11:14565202-14565224 ATTATCCTTTAGATGTCTGCAGG + Intronic
1079868760 11:25768912-25768934 TTGATCTTAGAGACCACTGCTGG + Intergenic
1089109150 11:116040955-116040977 ATGATCCTCTAGATCAGTGCTGG + Intergenic
1089134183 11:116236072-116236094 ATGATACTATATACCTCGTCTGG - Intergenic
1094703457 12:32892985-32893007 ATGCTGCTATACACCTCTGAAGG + Intronic
1096551471 12:52376328-52376350 ATCATCCTTCACACCTCTGCTGG + Intergenic
1105915853 13:24915180-24915202 AAGATCCTATTGATCTCTGGAGG - Intronic
1106493532 13:30251855-30251877 ATGACCCTGTAGACCTCAGGGGG + Intronic
1108010989 13:46010334-46010356 ATCACCCTACTGACCTCTGCTGG + Exonic
1108757624 13:53522947-53522969 ATGATCTCATTGAACTCTGCTGG + Intergenic
1111867894 13:93792605-93792627 AAAATCCTATAGACCTGGGCTGG - Intronic
1122738920 14:103859609-103859631 CTGGTCCCATAAACCTCTGCAGG + Intergenic
1125352142 15:38779192-38779214 GTGCCTCTATAGACCTCTGCAGG - Intergenic
1133877251 16:9746906-9746928 AAGATCCTGTAGTCTTCTGCTGG - Intergenic
1138413201 16:56855584-56855606 AAGATCCTTTACAGCTCTGCTGG + Intergenic
1140053229 16:71501616-71501638 ATGATCCTCTTGAGCTATGCCGG - Intronic
1141372136 16:83497758-83497780 ATGATCTAATAGACCAGTGCTGG - Intronic
1158747788 18:60221253-60221275 ATGATCCAATATCCCACTGCTGG - Intergenic
1165122620 19:33570356-33570378 CTGATCCTTTTGACCTCTGGGGG + Intergenic
1166657875 19:44625559-44625581 GTAATCCTATATACCTCTTCAGG + Intronic
1167287867 19:48608922-48608944 GTGATGCTACTGACCTCTGCTGG + Intronic
932048610 2:68376484-68376506 ATGATCCTATAGACCTCTGCAGG - Intronic
940617610 2:156069576-156069598 TTTAAGCTATAGACCTCTGCAGG - Intergenic
942861006 2:180612100-180612122 ATCTTCATATAGACCTCTGCAGG - Intergenic
944556061 2:200889019-200889041 TTGAACCAACAGACCTCTGCTGG - Exonic
947633024 2:231665948-231665970 ACGAGCCCACAGACCTCTGCAGG - Intergenic
1168928496 20:1602253-1602275 ATGATCCTTTTGATGTCTGCAGG - Intronic
1172591803 20:36122960-36122982 CTGATCCTATCGACATCTCCAGG - Intronic
1174227421 20:49013352-49013374 ACAAACCTATGGACCTCTGCGGG - Intronic
1178024808 21:28454046-28454068 ATGAGCCTATGGATCTCTGAAGG - Intergenic
949328883 3:2899164-2899186 AAGGGCCTAGAGACCTCTGCTGG + Intronic
953015785 3:39074773-39074795 ATGTTGCTATACATCTCTGCTGG - Exonic
953228295 3:41041077-41041099 ATGATTCTATAGATCTGTGCTGG + Intergenic
956523201 3:70128063-70128085 TTGATCCTACATACTTCTGCGGG - Intergenic
962239926 3:133743828-133743850 ATGCTCCTATAGACATATACAGG + Intergenic
962250587 3:133833689-133833711 CTGATCCTATAGGCCTCTGAGGG - Intronic
963027517 3:140934084-140934106 ATGAGTCTGTTGACCTCTGCTGG - Intergenic
964364707 3:155937420-155937442 ATGAACCTATTCCCCTCTGCAGG - Intronic
971957035 4:33434172-33434194 ATGATCATACAGACCACTACAGG - Intergenic
975757110 4:77581742-77581764 ATTAGCCTATAGACCTTTTCTGG + Intronic
978824834 4:113009613-113009635 ATGATTCTAGAGACTTCAGCTGG + Intronic
978980362 4:114937658-114937680 ATAATCTTATAGAACTCTGATGG + Intronic
982402189 4:154980764-154980786 ATGATCCTCTCAACCTCTACTGG + Intergenic
985664128 5:1173008-1173030 ATGAAGCTGCAGACCTCTGCGGG + Intergenic
986576105 5:9214378-9214400 CTGATCCTCTGCACCTCTGCAGG - Intronic
990197299 5:53333114-53333136 AGGATGCTACAGAACTCTGCAGG - Intergenic
990695709 5:58414491-58414513 ATGATGCCCTAGACCTCTGATGG - Intergenic
1001964921 5:175903345-175903367 ATGTTCCTGCAGACCTGTGCTGG - Intergenic
1002252034 5:177935843-177935865 ATGTTCCTGCAGACCTGTGCTGG + Intergenic
1003373936 6:5556567-5556589 ATCAGCCCATAGACCTCTGATGG - Intronic
1008751712 6:54742081-54742103 ATTATCCTTTAGATATCTGCAGG - Intergenic
1021106476 7:16645095-16645117 ATGACCCTTTAGACTTCCGCAGG - Intronic
1027591893 7:80128647-80128669 CAGATCCTATAGAGCTGTGCAGG - Intergenic
1034827061 7:154275243-154275265 CTGCTCCTAGAGTCCTCTGCAGG + Intronic
1043091835 8:75914058-75914080 AGGATTCTATAGATCTATGCTGG + Intergenic
1044174540 8:89102034-89102056 ATAATCATATAAAACTCTGCTGG - Intergenic
1044291448 8:90475509-90475531 ATGAGCCAATAGAACTCTGTGGG - Intergenic
1044365565 8:91341418-91341440 ATGGTCCTACAGAGCTGTGCTGG + Intronic
1047630075 8:126697228-126697250 ATGATCCTATACATTTCTACTGG - Intergenic
1048959709 8:139566020-139566042 ATGATACTAAAGACCTCTTATGG + Intergenic
1059617115 9:115963178-115963200 GTGATCCTAGAGACCCTTGCAGG + Intergenic
1059997346 9:119924944-119924966 TTGACCCTAAAGCCCTCTGCAGG - Intergenic