ID: 932049014

View in Genome Browser
Species Human (GRCh38)
Location 2:68380607-68380629
Sequence CCTGGCATTTGGGTTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 239}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932049002_932049014 -5 Left 932049002 2:68380589-68380611 CCACCACCCACACCCCACCCTGG 0: 1
1: 0
2: 25
3: 273
4: 1860
Right 932049014 2:68380607-68380629 CCTGGCATTTGGGTTTCTCTTGG 0: 1
1: 0
2: 1
3: 29
4: 239
932049001_932049014 2 Left 932049001 2:68380582-68380604 CCTCTCACCACCACCCACACCCC 0: 1
1: 1
2: 36
3: 442
4: 2564
Right 932049014 2:68380607-68380629 CCTGGCATTTGGGTTTCTCTTGG 0: 1
1: 0
2: 1
3: 29
4: 239
932049004_932049014 -8 Left 932049004 2:68380592-68380614 CCACCCACACCCCACCCTGGCAT 0: 1
1: 1
2: 4
3: 101
4: 838
Right 932049014 2:68380607-68380629 CCTGGCATTTGGGTTTCTCTTGG 0: 1
1: 0
2: 1
3: 29
4: 239
932049000_932049014 3 Left 932049000 2:68380581-68380603 CCCTCTCACCACCACCCACACCC 0: 1
1: 0
2: 21
3: 246
4: 1748
Right 932049014 2:68380607-68380629 CCTGGCATTTGGGTTTCTCTTGG 0: 1
1: 0
2: 1
3: 29
4: 239
932048999_932049014 15 Left 932048999 2:68380569-68380591 CCTTGGGCTGGTCCCTCTCACCA 0: 1
1: 0
2: 3
3: 24
4: 260
Right 932049014 2:68380607-68380629 CCTGGCATTTGGGTTTCTCTTGG 0: 1
1: 0
2: 1
3: 29
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932049014 Original CRISPR CCTGGCATTTGGGTTTCTCT TGG Intronic