ID: 932052496

View in Genome Browser
Species Human (GRCh38)
Location 2:68412693-68412715
Sequence CTGTAGTGAAGGAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932052496_932052502 7 Left 932052496 2:68412693-68412715 CCCTCTGCTCTCCTTCACTACAG No data
Right 932052502 2:68412723-68412745 GGCCTCTTGTTGGTCCTTGGAGG No data
932052496_932052500 -3 Left 932052496 2:68412693-68412715 CCCTCTGCTCTCCTTCACTACAG No data
Right 932052500 2:68412713-68412735 CAGACATACTGGCCTCTTGTTGG No data
932052496_932052501 4 Left 932052496 2:68412693-68412715 CCCTCTGCTCTCCTTCACTACAG No data
Right 932052501 2:68412720-68412742 ACTGGCCTCTTGTTGGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932052496 Original CRISPR CTGTAGTGAAGGAGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr